ID: 1066375736

View in Genome Browser
Species Human (GRCh38)
Location 10:34856483-34856505
Sequence AGGGGTTCTTATGATGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066375736_1066375738 -10 Left 1066375736 10:34856483-34856505 CCTGCAGCATCATAAGAACCCCT No data
Right 1066375738 10:34856496-34856518 AAGAACCCCTGTCTTCTGGCAGG No data
1066375736_1066375739 -9 Left 1066375736 10:34856483-34856505 CCTGCAGCATCATAAGAACCCCT No data
Right 1066375739 10:34856497-34856519 AGAACCCCTGTCTTCTGGCAGGG No data
1066375736_1066375746 30 Left 1066375736 10:34856483-34856505 CCTGCAGCATCATAAGAACCCCT No data
Right 1066375746 10:34856536-34856558 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
1066375736_1066375744 27 Left 1066375736 10:34856483-34856505 CCTGCAGCATCATAAGAACCCCT No data
Right 1066375744 10:34856533-34856555 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
1066375736_1066375743 26 Left 1066375736 10:34856483-34856505 CCTGCAGCATCATAAGAACCCCT No data
Right 1066375743 10:34856532-34856554 TGCCTGTAATCCCAGCACTTTGG 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066375736 Original CRISPR AGGGGTTCTTATGATGCTGC AGG (reversed) Intergenic
No off target data available for this crispr