ID: 1066379896

View in Genome Browser
Species Human (GRCh38)
Location 10:34892328-34892350
Sequence TCGAGGAAACAGAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066379891_1066379896 7 Left 1066379891 10:34892298-34892320 CCCTGGGAAAATGAGTTGGGAGA No data
Right 1066379896 10:34892328-34892350 TCGAGGAAACAGAATGAGGAGGG No data
1066379892_1066379896 6 Left 1066379892 10:34892299-34892321 CCTGGGAAAATGAGTTGGGAGAG No data
Right 1066379896 10:34892328-34892350 TCGAGGAAACAGAATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066379896 Original CRISPR TCGAGGAAACAGAATGAGGA GGG Intergenic
No off target data available for this crispr