ID: 1066390402

View in Genome Browser
Species Human (GRCh38)
Location 10:34973491-34973513
Sequence AAGGGCCTATTGAACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066390396_1066390402 8 Left 1066390396 10:34973460-34973482 CCTTCAAGTGCATGGAACATGAT No data
Right 1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG No data
1066390392_1066390402 25 Left 1066390392 10:34973443-34973465 CCGTATGCCTTTTTAACCCTTCA No data
Right 1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG No data
1066390395_1066390402 9 Left 1066390395 10:34973459-34973481 CCCTTCAAGTGCATGGAACATGA No data
Right 1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG No data
1066390393_1066390402 18 Left 1066390393 10:34973450-34973472 CCTTTTTAACCCTTCAAGTGCAT No data
Right 1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066390402 Original CRISPR AAGGGCCTATTGAACTCTGG GGG Intergenic