ID: 1066391203

View in Genome Browser
Species Human (GRCh38)
Location 10:34978591-34978613
Sequence TTGTAGGGATGGAGGGACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066391195_1066391203 9 Left 1066391195 10:34978559-34978581 CCAGAGAGACAAGGCAGTGGCGT No data
Right 1066391203 10:34978591-34978613 TTGTAGGGATGGAGGGACATGGG No data
1066391194_1066391203 10 Left 1066391194 10:34978558-34978580 CCCAGAGAGACAAGGCAGTGGCG No data
Right 1066391203 10:34978591-34978613 TTGTAGGGATGGAGGGACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066391203 Original CRISPR TTGTAGGGATGGAGGGACAT GGG Intergenic
No off target data available for this crispr