ID: 1066395788

View in Genome Browser
Species Human (GRCh38)
Location 10:35020265-35020287
Sequence CTGAGAAGTGGGGAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066395782_1066395788 10 Left 1066395782 10:35020232-35020254 CCTGGTCTGTTCAAAACAGTGTG 0: 1
1: 0
2: 1
3: 13
4: 161
Right 1066395788 10:35020265-35020287 CTGAGAAGTGGGGAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066395788 Original CRISPR CTGAGAAGTGGGGAGGTGGA AGG Intronic
No off target data available for this crispr