ID: 1066402363

View in Genome Browser
Species Human (GRCh38)
Location 10:35088892-35088914
Sequence TGGGCTGGGCGCAGTAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066402356_1066402363 26 Left 1066402356 10:35088843-35088865 CCCCAACTCATAAACAGCAATTG 0: 1
1: 0
2: 0
3: 17
4: 164
Right 1066402363 10:35088892-35088914 TGGGCTGGGCGCAGTAGCTCAGG No data
1066402358_1066402363 24 Left 1066402358 10:35088845-35088867 CCAACTCATAAACAGCAATTGAA 0: 1
1: 0
2: 3
3: 16
4: 217
Right 1066402363 10:35088892-35088914 TGGGCTGGGCGCAGTAGCTCAGG No data
1066402355_1066402363 27 Left 1066402355 10:35088842-35088864 CCCCCAACTCATAAACAGCAATT 0: 1
1: 0
2: 1
3: 21
4: 201
Right 1066402363 10:35088892-35088914 TGGGCTGGGCGCAGTAGCTCAGG No data
1066402357_1066402363 25 Left 1066402357 10:35088844-35088866 CCCAACTCATAAACAGCAATTGA 0: 1
1: 0
2: 0
3: 18
4: 195
Right 1066402363 10:35088892-35088914 TGGGCTGGGCGCAGTAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066402363 Original CRISPR TGGGCTGGGCGCAGTAGCTC AGG Intronic
No off target data available for this crispr