ID: 1066405843

View in Genome Browser
Species Human (GRCh38)
Location 10:35117235-35117257
Sequence TCACGAAGGCTGGTGTGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066405838_1066405843 17 Left 1066405838 10:35117195-35117217 CCAGATACTGGTATATGTTTAGC No data
Right 1066405843 10:35117235-35117257 TCACGAAGGCTGGTGTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066405843 Original CRISPR TCACGAAGGCTGGTGTGGAC TGG Intergenic
No off target data available for this crispr