ID: 1066409626

View in Genome Browser
Species Human (GRCh38)
Location 10:35154240-35154262
Sequence AAATCTTCTTGGTCCCACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066409622_1066409626 -9 Left 1066409622 10:35154226-35154248 CCCAGCTATGCCAAAAATCTTCT 0: 1
1: 0
2: 2
3: 16
4: 194
Right 1066409626 10:35154240-35154262 AAATCTTCTTGGTCCCACATAGG 0: 1
1: 0
2: 0
3: 8
4: 123
1066409623_1066409626 -10 Left 1066409623 10:35154227-35154249 CCAGCTATGCCAAAAATCTTCTT 0: 1
1: 0
2: 1
3: 8
4: 180
Right 1066409626 10:35154240-35154262 AAATCTTCTTGGTCCCACATAGG 0: 1
1: 0
2: 0
3: 8
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066409626 Original CRISPR AAATCTTCTTGGTCCCACAT AGG Intronic
900893025 1:5463360-5463382 ACATCTTCTTTGTCCCCCACAGG - Intergenic
901366874 1:8759933-8759955 AAATCTTCCTTTTCCCATATAGG - Intronic
901952292 1:12758665-12758687 AAATCCTCTTGGGCCCAGAAGGG - Intronic
902803988 1:18849482-18849504 AAATCTTCTTCGACCCGCAAGGG - Exonic
902872937 1:19325157-19325179 AGAACTTTCTGGTCCCACATGGG - Intronic
905467648 1:38167447-38167469 AACTCTTGCTTGTCCCACATTGG - Intergenic
906024619 1:42662644-42662666 AAATATTCTTGGTCAAACTTTGG - Intronic
906631530 1:47373115-47373137 AAATCTTCATCTGCCCACATAGG + Intronic
906670189 1:47648665-47648687 AAGTCTCCAGGGTCCCACATAGG + Intergenic
911770655 1:101736891-101736913 ATATCTTCTTGTTCCCACAAGGG + Intergenic
912188364 1:107307943-107307965 AAATATTGTTGGGCCCACTTAGG + Intronic
920645578 1:207801236-207801258 AAAACTCCTTAGTTCCACATGGG - Intergenic
923987800 1:239401313-239401335 AGATCTTCTTCCTCCCACACTGG + Intronic
924405957 1:243746054-243746076 AGATCTTTTTGATTCCACATAGG - Intronic
1064228740 10:13510689-13510711 AAATCTGCCTGGTTCCAAATAGG + Intronic
1065454723 10:25895068-25895090 AAATTTTCTTGGTGTTACATTGG - Intergenic
1066409626 10:35154240-35154262 AAATCTTCTTGGTCCCACATAGG + Intronic
1067444506 10:46332375-46332397 ACATCTTCATGTTTCCACATGGG - Intergenic
1069303615 10:66940094-66940116 GAATCTGCTTGGTCCAACTTAGG + Intronic
1071398176 10:85243638-85243660 AAATGTACTTGGTCACACAAAGG - Intergenic
1074055048 10:109915743-109915765 CAAACTTCTTGTTCCCATATGGG + Intronic
1078065482 11:8076258-8076280 AAATGGTCTTGGTGCCACAGTGG - Intronic
1078533338 11:12153849-12153871 GAATCATCTTGATCCCACATTGG - Intronic
1079311781 11:19372982-19373004 AAATGTTCGTTGTCCCTCATAGG - Intronic
1081657225 11:44865443-44865465 GCATCTTCTTGCTCCCACACGGG + Intronic
1087062526 11:93995010-93995032 AAATCTTGTTGTTCTAACATAGG - Intergenic
1087062600 11:93995795-93995817 AAATCTTGTTGTTCTAACATAGG + Intergenic
1089847467 11:121469755-121469777 AAAGCTTCTTGGGCTCTCATTGG - Intronic
1090992871 11:131836361-131836383 AAATCTTCTTGGATCTAAATAGG + Intronic
1091262917 11:134248024-134248046 TCATCTTCTGGGTCCCACAGAGG - Intergenic
1095858075 12:46883971-46883993 AACTCTACTTGGTTCCACTTTGG + Intergenic
1096040072 12:48507432-48507454 GAATCTTCGTCGCCCCACATTGG - Intronic
1100440009 12:94608317-94608339 AACTGTTCTTGTTCCCACCTAGG + Intronic
1101206032 12:102488270-102488292 AAAGGTTCATAGTCCCACATAGG - Intergenic
1101825334 12:108216029-108216051 AAATCCTCTCGGCCCCACAGTGG - Intronic
1102342872 12:112137412-112137434 AACTGTCCTTGGTTCCACATGGG - Intronic
1107741860 13:43459166-43459188 AAATGTTGATGGTACCACATAGG - Intronic
1109482816 13:62978446-62978468 AAATCTTCTTGGTCCAGGAATGG + Intergenic
1112817753 13:103292882-103292904 AAACATTCTTGGAGCCACATGGG + Intergenic
1113081554 13:106525732-106525754 AAATGTGCTTGCTCCCACCTGGG + Intronic
1114661102 14:24345400-24345422 AAATCTTTTTGGTCCCACCATGG - Intergenic
1120632066 14:86903764-86903786 TAATCTTCTATGTACCACATTGG - Intergenic
1122501042 14:102199778-102199800 AAATATACTTGTTCCCAGATGGG - Intronic
1124814272 15:32973094-32973116 AAATCTTCTTGGAACCAAAGTGG - Intronic
1131105079 15:89728351-89728373 GAATGTTCTTGTTCTCACATGGG + Intronic
1133276519 16:4641323-4641345 AAATCCTATTGCTCACACATGGG - Intronic
1144412279 17:15012741-15012763 AAATGTTCTTGCTGACACATGGG - Intergenic
1152833618 17:82514940-82514962 AAAGCATCTTGGTCCAACCTGGG - Intergenic
1153556042 18:6315022-6315044 AAATCATATTGGTACCATATAGG + Intronic
1157419477 18:47533333-47533355 ACATCTTATTGTTCCCACTTCGG - Intergenic
1160159801 18:76462348-76462370 ACATCTTCCTGTTCCCACAAGGG + Intronic
1160224887 18:77005004-77005026 AAACCTTGTGGGACCCACATTGG + Intronic
1160962261 19:1727865-1727887 AAATCTTCTTGGCTCCACACAGG - Intergenic
1163131498 19:15276279-15276301 AAGTCATCTGGGTCTCACATAGG - Intronic
925507563 2:4584834-4584856 AAATATTTTTGATCCCAGATTGG - Intergenic
925846029 2:8034184-8034206 AAATCTACTTGGTTCCAGGTTGG + Intergenic
928875527 2:36034146-36034168 TAATCTTCTGGGTCCTCCATAGG + Intergenic
930500590 2:52212215-52212237 AAATCTTCTAGTACCCACAACGG - Intergenic
933110173 2:78388564-78388586 ACATATTCTTGCTCACACATAGG - Intergenic
934836301 2:97592289-97592311 CAATCTTCTTTGTCCTACAAGGG + Intergenic
936508270 2:113125358-113125380 AATTCTTCTTTGGCCCTCATAGG + Intronic
936545505 2:113389158-113389180 CAATCTTCTTTGTCCTACAAGGG - Intergenic
936909195 2:117572754-117572776 CAGTCTTCTTGGTCCCTCAGTGG + Intergenic
937070102 2:119056812-119056834 AAATCCCGTTGTTCCCACATTGG + Intergenic
938260463 2:129892079-129892101 ATATCTGCTGGGTCCCTCATCGG + Intergenic
940261035 2:151779998-151780020 GAATTTTCTTTTTCCCACATTGG + Intergenic
940735341 2:157444801-157444823 CAATGTTCTTGGTGCCACCTTGG - Intronic
944316513 2:198290954-198290976 ATGTCTTCTTGGCCCCAAATTGG - Intronic
945345177 2:208704835-208704857 AAATCTTCTTGAGCCGACAATGG + Intronic
945787744 2:214264217-214264239 AAATATTCTTGGTCTTATATAGG - Intronic
1169946529 20:10995114-10995136 AAGTCCTCTTGGTCCCCCAGAGG + Intergenic
1171101819 20:22390813-22390835 ATTTGTTCTTGGTCACACATTGG - Intergenic
1172088031 20:32404224-32404246 AACTCTTTTAGCTCCCACATAGG + Intronic
1178037904 21:28605158-28605180 AAAGCTTCTGGTTCCCAAATGGG - Intergenic
1181860586 22:25814944-25814966 AGAACCTCTTGGTCCCAGATTGG - Intronic
1182829123 22:33290494-33290516 CAATCTTCTTGGTCCCTCCCAGG - Intronic
949492384 3:4601623-4601645 AAATCTTCATGGTCCTGAATTGG + Intronic
957482460 3:80816240-80816262 AAATCCTCTGGGCTCCACATGGG - Intergenic
957864894 3:86009654-86009676 AAAGCTTCTTTCTCCCCCATGGG + Intronic
957926421 3:86819132-86819154 AAATCTTCTTGGCTCCATACAGG - Intergenic
959010393 3:101069257-101069279 AAATCTTATTGTTACCAAATAGG + Intergenic
959621970 3:108408537-108408559 AAAATTTCTCGGTCCCATATAGG - Intronic
967131986 3:186478897-186478919 AAATATTTTTGCTCTCACATTGG + Intergenic
969991544 4:11269132-11269154 AAATATACTAGGTTCCACATAGG + Intergenic
980240137 4:130162282-130162304 AAGTCTTCTTTATCACACATTGG + Intergenic
980685468 4:136221076-136221098 AATTCTTCTTGGTTCAATATCGG + Intergenic
984724288 4:183005083-183005105 CATTCTTCTTAGTGCCACATGGG + Intergenic
986118093 5:4800552-4800574 AAATCTTCTTGCTCCTAAGTTGG - Intergenic
988346635 5:30045062-30045084 AAAGCTTGTTGTTCACACATTGG + Intergenic
990055913 5:51577844-51577866 AACTCTTTTAGCTCCCACATAGG - Intergenic
990206413 5:53434237-53434259 TATTCTACTTGGTCCCTCATCGG - Intergenic
991527794 5:67581310-67581332 GAATCTCCTTGGTCCCAAACTGG - Intergenic
992035608 5:72771973-72771995 AATTAATCTTGGTCCTACATTGG + Intergenic
994784056 5:104132922-104132944 CAATCCTCTTGGTCCCTCAGTGG + Intergenic
996044696 5:118858068-118858090 TAAGCTTATTGCTCCCACATGGG - Intronic
998997088 5:147877603-147877625 AAATTTTCTGGGTTCCACTTTGG + Intronic
1001131170 5:169064832-169064854 AAATCTCTTTGGTCCCTCATAGG - Intronic
1003066369 6:2906570-2906592 AAATCTTCTGTCTCCCACACCGG + Intergenic
1005814420 6:29539133-29539155 AGATATTCTGAGTCCCACATGGG + Intergenic
1010823915 6:80450042-80450064 TAGTCTTCTTGGTCCCAAGTTGG + Intergenic
1011377384 6:86704450-86704472 CATTCTTCTTGGTGCCACATGGG - Intergenic
1012067209 6:94563268-94563290 AATTCTTCTTGGTCCCTGTTTGG - Intergenic
1013293480 6:108738513-108738535 AAATTTTCTTGGTGCCAGACTGG - Intergenic
1013781001 6:113728356-113728378 AAATCTTCTTGGATCTAAATAGG - Intergenic
1017502099 6:155035035-155035057 AAAGCTTCGTGGACCCATATAGG - Intronic
1018921003 6:168174150-168174172 AAATCTTGTTGTTCTAACATGGG - Intergenic
1021894576 7:25222023-25222045 AAATCTTCCGGGCCCCACAGTGG - Intergenic
1021948298 7:25749963-25749985 AAGTATTCCTGGTCCAACATAGG - Intergenic
1024188576 7:46981375-46981397 AATTCTTTTTGGTCCCAGAATGG - Intergenic
1034514596 7:151565049-151565071 AAATGTTCTTGTTTCCACGTAGG - Intronic
1037384618 8:18324858-18324880 AAATGTTCTTTGTAGCACATAGG - Intergenic
1041916793 8:63146607-63146629 GAACCTTCTTGGACCGACATTGG + Intergenic
1044359824 8:91270079-91270101 AATTCTTCTTGGTCCATTATTGG + Intronic
1052541822 9:29820778-29820800 ATTTCTTCTTGGTTCAACATTGG - Intergenic
1052543573 9:29843551-29843573 AAATCCTCTGGGTTCCACATAGG - Intergenic
1053461785 9:38277107-38277129 AAATCATCTCAGTCTCACATGGG - Intergenic
1053541232 9:38975936-38975958 AAATCTAATCAGTCCCACATAGG + Intergenic
1054624906 9:67387970-67387992 AAATCTAATCAGTCCCACATAGG - Intergenic
1055193326 9:73554764-73554786 AAATATACTTGTTGCCACATAGG - Intergenic
1055299168 9:74865152-74865174 AAATCTTCCTGGAGCCAAATAGG + Intronic
1055943220 9:81669975-81669997 AAATTTTCTTGTTCCCAGACGGG + Intronic
1058535963 9:105960501-105960523 AAATGTTCTTCTTCCCACCTCGG - Intergenic
1190588656 X:51974451-51974473 AATTCCTCTTGGTCCCAGACTGG - Intergenic
1191038953 X:56058113-56058135 CAATCATCTTGGTCCCTCAGTGG + Intergenic
1192737123 X:73860517-73860539 AATTCTTCGTGGTCACACACTGG + Intergenic
1194310622 X:92301449-92301471 AAACCTTCTGGGCTCCACATAGG + Intronic
1196084611 X:111671822-111671844 AAAACTTCTGAGTCCCAGATGGG + Intronic
1196421844 X:115530598-115530620 TAAACTTCTTGGTCCCCTATGGG + Intergenic
1196590653 X:117482607-117482629 ATTTCTTCTTGGTCCAATATTGG + Intergenic
1198839206 X:140838648-140838670 AAGTCTTCTAGGTCCCCCATGGG + Intergenic
1199043466 X:143141033-143141055 AAAGCTTCTTTGTCACCCATGGG - Intergenic
1200618904 Y:5415735-5415757 AAACCTTCTGGGCTCCACATAGG + Intronic