ID: 1066411914

View in Genome Browser
Species Human (GRCh38)
Location 10:35179725-35179747
Sequence CAGTTTTTCCTAAAAGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 436}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066411914 Original CRISPR CAGTTTTTCCTAAAAGAGAA TGG Intronic
902138051 1:14327722-14327744 CACTGTTTACTCAAAGAGAATGG + Intergenic
905008074 1:34727166-34727188 CAGTTCTTCCTGAAGCAGAAAGG - Intronic
908054572 1:60269596-60269618 GAATATTTCCTTAAAGAGAATGG + Intergenic
908828827 1:68159239-68159261 CATTTTCTCCTGCAAGAGAAAGG + Exonic
909702455 1:78542423-78542445 CATTGTTTCTTAGAAGAGAATGG - Intergenic
910265121 1:85330410-85330432 CATTTTTTCCTAAAAAAGCATGG + Intronic
910419515 1:87042652-87042674 CAATTTTTTCTGAAAGAAAAGGG - Intronic
910423520 1:87096784-87096806 CAGTTTTTCCTTCAAGTGACAGG + Intronic
910572917 1:88725827-88725849 CATTTTTTTCTAAAAGATAAAGG + Intronic
910662529 1:89689072-89689094 AAGATTTTCCTAAAGGGGAAAGG + Intronic
911569941 1:99508990-99509012 CAGTTTTGTCGAAAAGAGAAGGG + Intergenic
912118970 1:106444366-106444388 CATTTCTTCCTAATTGAGAACGG + Intergenic
913240931 1:116828673-116828695 AGGTTTTTGCCAAAAGAGAAAGG - Intergenic
913593933 1:120355249-120355271 CATTTTTTTCTAACAAAGAAGGG - Intergenic
914093322 1:144523737-144523759 CATTTTTTTCTAACAAAGAAGGG + Intergenic
914305205 1:146410163-146410185 CATTTTTTTCTAACAAAGAAGGG - Intergenic
914596854 1:149162660-149162682 CATTTTTTTCTAACAAAGAAGGG + Intergenic
914770410 1:150679055-150679077 CATTTTTTCCTAAAACAAACAGG + Intronic
915099889 1:153491489-153491511 GAGTTTTTCCTCATAGAGGAAGG + Intergenic
915166426 1:153950412-153950434 CAGTCTTTCCTACAAAAGAGGGG + Intronic
916204688 1:162304507-162304529 TATTTCTTCCTAAAAGTGAATGG - Intronic
916320288 1:163498245-163498267 CAGTTTTGTCGAAAAGAAAAGGG - Intergenic
916391355 1:164334158-164334180 CAGCTCTTCCTAAATGAGAGGGG + Intergenic
917122328 1:171655472-171655494 CAGTGTTTCCTCAGAGGGAAAGG - Intergenic
917453074 1:175163255-175163277 CAGTCTTTCCTACAATAGACTGG - Intronic
918392936 1:184085183-184085205 AAGTTCTCTCTAAAAGAGAAGGG + Intergenic
918702032 1:187617262-187617284 CAGTTTTGTCGAAAAGAAAAGGG + Intergenic
919255895 1:195124587-195124609 CATATTTTAGTAAAAGAGAAAGG + Intergenic
919267799 1:195294942-195294964 GAGTATTTCCAAGAAGAGAATGG - Intergenic
919509531 1:198444282-198444304 CAGTTATTTCTAAAACAAAATGG + Intergenic
919535960 1:198788284-198788306 CTGTTTTTCCTAAAAAAGCCAGG - Intergenic
919584762 1:199422620-199422642 CACTGTTTCCTTGAAGAGAAGGG + Intergenic
920457180 1:206110180-206110202 GAGTCTTTCCTAAAAGATGATGG + Exonic
923736971 1:236619370-236619392 TAGATACTCCTAAAAGAGAATGG + Intergenic
923767393 1:236904963-236904985 AACCTTTTCCTAAAAGAGACAGG + Intergenic
923807269 1:237271332-237271354 GATCTTTGCCTAAAAGAGAATGG + Intronic
923901058 1:238326955-238326977 CAGTTTTGTCAAAAAGAAAAGGG - Intergenic
923936230 1:238763294-238763316 CAGTTTTGTCAAAAAGAAAAGGG - Intergenic
924023325 1:239808075-239808097 CAGTTTTTCAAAAAATAAAAAGG - Intronic
924099371 1:240587968-240587990 CAGTTTTCCATCAAAGAGCAAGG - Intronic
1063060976 10:2552345-2552367 CAGCTTTTGCTGAAAGAGATTGG - Intergenic
1065022446 10:21510925-21510947 TAGTTTTTCCTTACAGGGAAGGG + Intergenic
1066411914 10:35179725-35179747 CAGTTTTTCCTAAAAGAGAATGG + Intronic
1066593492 10:37022107-37022129 CAAATTTTCCAAATAGAGAATGG + Intergenic
1068003583 10:51366269-51366291 CAGTTTTTCCTAGTAGAACATGG + Intronic
1068083848 10:52349772-52349794 CCATTTGTCCTAAAAGAGTAAGG - Intergenic
1068965683 10:62910406-62910428 CAGTTTCTCCCAAATGCGAATGG + Intronic
1071370096 10:84942454-84942476 CAGTATTTCCCCCAAGAGAATGG + Intergenic
1073474220 10:103742383-103742405 CAGGTGTTCTTATAAGAGAAAGG - Intronic
1075118338 10:119646092-119646114 CAGTTTTTGCCATAATAGAAGGG + Intergenic
1075304212 10:121353514-121353536 AAAATTGTCCTAAAAGAGAAAGG + Intergenic
1077040255 11:517710-517732 CAGTTTTGTCAAAAAGAAAAGGG + Intergenic
1077288557 11:1778370-1778392 CAGGTTCTCCCAGAAGAGAAGGG - Intergenic
1078859914 11:15237484-15237506 CACTGTTTCCTGAAAGAGCAGGG - Intronic
1079487567 11:20951573-20951595 CATTTTTCCCTAAAAGACAAGGG - Intronic
1079523117 11:21352498-21352520 GAGTTTTTCCTAATAAAGCATGG - Intronic
1080308243 11:30860016-30860038 CAGTTTTCCCTAGAAGAGAATGG - Intronic
1080370346 11:31632203-31632225 CTGTTTTTTCTAAAAGAAAGTGG - Exonic
1080437340 11:32257449-32257471 CAGGTTTTCATGAAAGGGAATGG - Intergenic
1080724892 11:34887238-34887260 CAGTTTTTCTGAAAAGAGTTTGG - Intronic
1081025461 11:38007755-38007777 CAGTCTTACCTAAGAGAAAAAGG - Intergenic
1082969493 11:59004701-59004723 CAGTTTTGTCAAAAAGAAAAGGG + Intronic
1083243312 11:61405882-61405904 CAGTTTTCCCTTAGAGAAAATGG - Intronic
1083393087 11:62369455-62369477 CAGTTTTGTCAAAAAGAAAAGGG - Intronic
1084413296 11:69016198-69016220 CTGTCTTTCCTAATAGTGAAAGG + Intergenic
1085894809 11:80626236-80626258 CAAATTTTCCAAATAGAGAATGG - Intergenic
1086393705 11:86392175-86392197 CAGTATGTCCTAAAAGATAAGGG + Intronic
1086609509 11:88738424-88738446 CAGCTTTTCCTACAATAGATGGG - Intronic
1087349796 11:97017428-97017450 GAGTTTCTCCCAAAAGAAAATGG - Intergenic
1087366664 11:97228522-97228544 CTCATTTTCCTAAAAGAGAAAGG - Intergenic
1088228354 11:107646112-107646134 TAGTTTTTTCTAATAGAGATGGG - Intronic
1090163191 11:124517239-124517261 CAGCTTTGCCTAGAGGAGAATGG - Intergenic
1090845574 11:130527362-130527384 CAGCTGTTCCAAAAACAGAAAGG + Intergenic
1091324428 11:134675457-134675479 GAGTTGTTCATAAAAGAGTAAGG - Intergenic
1091608848 12:1985511-1985533 CAGTTTTACCTCACAGAGCATGG + Intronic
1092096480 12:5846763-5846785 CAGGTATCCCTATAAGAGAAAGG - Intronic
1093297695 12:17411240-17411262 CAGTTGTCCCTATAAGAGACTGG - Intergenic
1095531380 12:43190432-43190454 CAGTTGTTCCCATCAGAGAAGGG + Intergenic
1096054975 12:48642769-48642791 CAGTTTTGTCGAAAAGAAAAGGG + Intergenic
1096172446 12:49483206-49483228 CTCTTTTCCCTAAAAGAGATTGG + Intronic
1096329249 12:50695300-50695322 CAGGTTTTCATAACAGAGTAGGG - Exonic
1096953502 12:55501168-55501190 CAGTATTTGATAAAACAGAAAGG + Intergenic
1097347266 12:58507026-58507048 AGGTTTTTCTTAAAATAGAAGGG - Intergenic
1097462648 12:59881369-59881391 CAGTTTGACATTAAAGAGAATGG - Intergenic
1097550960 12:61068257-61068279 CAGAATTTCAGAAAAGAGAAAGG - Intergenic
1097591179 12:61577184-61577206 CAGTTTTTCCCAACACAAAAGGG - Intergenic
1097992396 12:65849672-65849694 GAGATTTTCCTAAATGAGAGTGG + Intronic
1098703748 12:73661819-73661841 CAGTTTTTCCAAATAAGGAAAGG - Intergenic
1099407230 12:82279813-82279835 CAGTTTTTCCTCACAAATAAAGG + Intronic
1100843854 12:98639950-98639972 GAGTTTTATCTAAAAGACAAGGG - Intronic
1100873000 12:98931859-98931881 CACTTTTTCCTGAAAGAGATTGG + Intronic
1101267192 12:103101410-103101432 TAGTTTTTCCTTAAAAATAATGG + Intergenic
1101569985 12:105944982-105945004 GAGTTTCTTCTAGAAGAGAAAGG - Intergenic
1102414210 12:112746538-112746560 CAATTTTTCCTATAAAAGAAGGG - Intronic
1102628332 12:114254531-114254553 CAGGTTTTCCTCAAGGGGAAGGG - Intergenic
1103749253 12:123148411-123148433 CATTTTTTCCAAAAACAGCAAGG + Intronic
1104110920 12:125703485-125703507 CAGTTTTCCCTAATACATAATGG + Intergenic
1104192113 12:126491864-126491886 TCTTTTTTCCTAAAAGAAAAGGG + Intergenic
1104507314 12:129344486-129344508 CAGTCTCTCCTAAGACAGAATGG + Intronic
1105411474 13:20174902-20174924 CAGGTTTTCTTAAAAGAGCATGG - Intergenic
1106190120 13:27445083-27445105 CAGTTCTTCCTAAAAAAGGTAGG - Exonic
1107109434 13:36680157-36680179 CAGTTTTGCCTTGAGGAGAATGG - Intronic
1107573544 13:41690495-41690517 CAATGCTTCCTATAAGAGAAAGG + Intronic
1107732641 13:43364257-43364279 CAGCTTTTCCTAACAGGGCATGG - Intronic
1108035194 13:46284056-46284078 CAGTTTTGTCGAAAAGAAAAAGG + Intergenic
1109365634 13:61352555-61352577 AAATTTTTCCTAAATTAGAATGG - Intergenic
1109441646 13:62382026-62382048 AAGTTCTTCCTTAAAGAAAAGGG + Intergenic
1109862302 13:68216220-68216242 CAGTTTTTCGTAAAGAAGAAAGG + Intergenic
1110042124 13:70775368-70775390 TAGTTTTTCCTTTAAGAGATCGG - Intergenic
1110114390 13:71794055-71794077 CATTTTTTCCTTAAAAAAAAAGG + Intronic
1110188405 13:72701722-72701744 CAGTTTTTCCTAAAATCCTAGGG + Intergenic
1110609298 13:77471193-77471215 CATTCCTTCCTAGAAGAGAAAGG - Intergenic
1112224913 13:97530190-97530212 GAGTGTTTCCTTAAAGAGAGTGG + Intergenic
1113466410 13:110516587-110516609 CAGTTTATCCTTAGAGAGGAAGG - Intergenic
1114478051 14:23011451-23011473 CAGTCTGTGCTGAAAGAGAATGG - Intergenic
1114607661 14:24010726-24010748 CAGTTTTGTCAAAAAGAAAAGGG - Intergenic
1115007330 14:28501019-28501041 CCATTTTTCTTGAAAGAGAAAGG - Intergenic
1116468727 14:45263027-45263049 TATTTTTTCCTAGAAGAGACTGG + Intergenic
1116502383 14:45635980-45636002 CAGTTTTGTCGAAAAGAAAAGGG + Intergenic
1116739049 14:48732242-48732264 CAGTTTTTCCTCAAATTAAAAGG + Intergenic
1116988414 14:51246264-51246286 CAATTTTGACTAAAAGAAAAAGG - Intronic
1118929085 14:70223548-70223570 GAGTTTTTCCTACAAGAAGAAGG - Intergenic
1119960651 14:78852286-78852308 CAGTTTTTCCTGGTAGAGAGTGG + Intronic
1120240127 14:81940233-81940255 CTCTTTCTCCTCAAAGAGAAAGG - Intergenic
1121697086 14:95922478-95922500 CAGTTTCTCCTTCAAGGGAAGGG + Intergenic
1122073966 14:99223920-99223942 CATTTTTTTCAAACAGAGAAAGG + Intronic
1123952997 15:25302146-25302168 CAATTTTTTTTAAAAAAGAATGG - Intergenic
1124512030 15:30335801-30335823 TAAATTTTCCTATAAGAGAAAGG + Intergenic
1124560571 15:30770203-30770225 CAGGTTTTCCTAAGAGGAAATGG + Intronic
1124670637 15:31635240-31635262 CAGGTTTTCCTAAGAGGAAATGG - Intronic
1124730884 15:32194950-32194972 TAAATTTTCCTATAAGAGAAAGG - Intergenic
1126402548 15:48287780-48287802 TAGTTTTTATTAAAAGACAATGG - Intronic
1126690484 15:51285457-51285479 CGGTTTTACAAAAAAGAGAAGGG + Intronic
1127163904 15:56223175-56223197 CAGTTGTTCTTAGAAGAGACTGG + Intronic
1127590874 15:60421785-60421807 CAGTGTTTTATAAAAGGGAATGG + Exonic
1127768636 15:62212133-62212155 CAGTTTTACAAAAAAGAAAAGGG - Intergenic
1127887733 15:63217761-63217783 CAGTTTTTCGGGAGAGAGAAGGG + Intronic
1127946572 15:63760991-63761013 CAGTTTATGCCAGAAGAGAATGG + Intronic
1128500329 15:68222667-68222689 CAGTTTTGTCAAAAAGAAAAGGG + Intronic
1130990438 15:88872764-88872786 AAGTTGGTGCTAAAAGAGAAAGG + Intronic
1131746900 15:95458443-95458465 CACTTTTTCCTGGAAGAAAATGG - Intergenic
1132318514 15:100908394-100908416 CAGTTGATCCTAGAAAAGAATGG - Exonic
1133536618 16:6708377-6708399 CATTTTTTCCTAAATCAGACAGG + Intronic
1133600509 16:7335770-7335792 CTGATTTTCCTAAAGGAGGAAGG - Intronic
1134759136 16:16698138-16698160 CCGTTTGTCCTACATGAGAAAGG - Intergenic
1134986938 16:18661046-18661068 CCGTTTGTCCTACATGAGAAAGG + Intergenic
1136989258 16:35142195-35142217 CAGCCTTTCCTAGAAGACAAAGG - Intergenic
1137792749 16:51188658-51188680 CAGTTTTTCTTGAAATTGAAGGG + Intergenic
1138137672 16:54537487-54537509 CAGTTTTTCCTGGGAGAGGAAGG + Intergenic
1138307450 16:55989895-55989917 CAGTTTTGTCGAAAAGAAAAGGG + Intergenic
1140520140 16:75574045-75574067 AAGTTTTACTTAAAAGACAATGG + Intronic
1140843757 16:78866828-78866850 CAGTTTTTCTTAAAATAGTAGGG + Intronic
1141716899 16:85732061-85732083 CAGTTGTCCTTAAAAGAGAAGGG + Intronic
1142376705 16:89710425-89710447 CACTGTTTCCAAAATGAGAAGGG + Intronic
1143772198 17:9175848-9175870 GATTTTTTCCATAAAGAGAAAGG - Intronic
1145222672 17:21102160-21102182 GAGTTTTTCCTTTAAGACAAGGG - Intergenic
1145384541 17:22404254-22404276 CACTTTGTCCTATAAGACAAAGG - Intergenic
1146247163 17:31297086-31297108 GACTTTTTCTTAAAAGAAAAAGG + Intronic
1146339311 17:32006444-32006466 CAGTTCTTCAGATAAGAGAAAGG - Intergenic
1146737132 17:35248097-35248119 CAGTTTCTCCTAGATGAGGAGGG - Intronic
1147839321 17:43359711-43359733 GAGTCTTTCCTAAAAGAGAGTGG - Intergenic
1148253947 17:46112007-46112029 CTGTATTTCCCAAAGGAGAATGG + Intronic
1148449770 17:47769069-47769091 CATTGTCTCCTAAATGAGAATGG - Intergenic
1148672124 17:49419274-49419296 CAGTTTTGTCAAAAAGAAAAGGG - Intronic
1149031820 17:52092231-52092253 AATTTTTTCTTAAAAGGGAAGGG + Intronic
1149081317 17:52661037-52661059 CATTTGTTCCTAAAATAAAAAGG + Intergenic
1150094968 17:62365832-62365854 TAATTTTTCCTAAATAAGAAGGG - Intergenic
1150584490 17:66505155-66505177 AAGTATTTCCTACAAGGGAAGGG + Intronic
1150971857 17:70037705-70037727 AAGTTTTCCATAAAAGAGAAAGG - Intergenic
1151588882 17:75030146-75030168 CAGTTTTACAAAAAAGAGAAGGG + Intergenic
1152355931 17:79807322-79807344 CTGTTTTTCCAAGATGAGAAAGG + Intergenic
1153078473 18:1193027-1193049 AAGGTTTTCCTAAGATAGAAGGG - Intergenic
1153482727 18:5563717-5563739 CATTTTTTGATAAAGGAGAAGGG + Intronic
1156467343 18:37356139-37356161 CAGTGGTTCCTAATAGAAAATGG - Intronic
1158046727 18:53164893-53164915 CAGTCTTTCTGAACAGAGAAAGG - Intronic
1158149151 18:54347558-54347580 AAGTTTTTCATAAAATGGAATGG + Intronic
1158371434 18:56810219-56810241 CAGATTTTCCTTAAAGCAAATGG + Intronic
1159570155 18:70103298-70103320 CAGTTTTGTCAAAAAGAAAAGGG + Intronic
1159607081 18:70485807-70485829 CAGTGTTTATTCAAAGAGAAAGG + Intergenic
1159662555 18:71116562-71116584 CAGGTTTTTATGAAAGAGAACGG - Intergenic
1163984950 19:20937512-20937534 CAGTTTGTCCAAAAATAAAATGG - Intronic
1164174106 19:22752972-22752994 ACCTTTTTCATAAAAGAGAAAGG - Intergenic
1166232442 19:41433054-41433076 CAGTTTTGACTAAAACAAAAAGG + Intronic
1167704028 19:51067816-51067838 CAGCTTTTCCCAAGTGAGAAAGG - Intergenic
1168430477 19:56275350-56275372 CAGCTTTTCCTTACAGAGAAAGG - Intronic
925082452 2:1081068-1081090 CTGTTTGCCGTAAAAGAGAAGGG - Intronic
926181013 2:10642929-10642951 CAGTAACTCCTCAAAGAGAAGGG + Intronic
926371859 2:12186627-12186649 AAAATTTTGCTAAAAGAGAAGGG + Intergenic
926958089 2:18323822-18323844 CAATTCTTCCTAAAAGTGAATGG - Intronic
928094766 2:28397502-28397524 CACTTTTTCATCAAAGGGAATGG + Intronic
928937481 2:36694295-36694317 CATTGTTTTTTAAAAGAGAATGG + Intergenic
929243923 2:39681803-39681825 CAGTTTTTACAAAGGGAGAAAGG + Intronic
929676024 2:43930585-43930607 AAGTTTTTCTCAAAGGAGAAAGG - Intronic
931484877 2:62680579-62680601 CAGTTTTGCATAAAACAGGAGGG + Intronic
931836361 2:66102791-66102813 CATTTTTTCATAAAATATAAAGG + Intergenic
932640720 2:73443056-73443078 CAGTAATTCAGAAAAGAGAATGG - Intronic
932871895 2:75409450-75409472 CAGAGTTTCCCAAAAGAGCAAGG - Intergenic
932938067 2:76129722-76129744 TATATTTTCCTAAAAGAAAAAGG - Intergenic
932961764 2:76420526-76420548 CAGTTTTTTTTAAAAGGCAAGGG + Intergenic
933044238 2:77515002-77515024 CAGCTTTTCCTAAAACAGTAAGG - Intronic
933260154 2:80123398-80123420 CAGCTTGTCCTTAAAGAGGATGG + Intronic
933371966 2:81425869-81425891 TAGTTTTACTTAAAAGATAAAGG - Intergenic
933534909 2:83559259-83559281 CTGTTTTTCATAAAAGACTATGG + Intergenic
933868252 2:86544792-86544814 CAGTTTTGTCAAAAAGAAAAGGG - Intronic
934128428 2:88920862-88920884 CAGTTTTGTCGAATAGAGAAGGG + Intergenic
934695277 2:96395567-96395589 CAGACTATCCTAGAAGAGAAAGG + Intergenic
934888683 2:98047084-98047106 CAGTCTCTCCTAAAACAGAGTGG + Intergenic
935085803 2:99843544-99843566 CTATTTTTCCTAACAGACAAAGG + Intronic
935497428 2:103798078-103798100 CATTTTGTCTTAAAACAGAATGG - Intergenic
936786362 2:116098336-116098358 GAGTTTTTCATTAAAGAAAAGGG + Intergenic
937536502 2:122895436-122895458 CAGATAATCCTAAAATAGAAGGG - Intergenic
937589589 2:123597172-123597194 CAGTTATTCCAAAAGGAAAAGGG - Intergenic
937923239 2:127146921-127146943 CAGGTTGTCCAAAAAGAGGATGG + Intergenic
938887227 2:135663521-135663543 CATTCTTATCTAAAAGAGAAAGG + Intronic
939877217 2:147591478-147591500 CAGTTTTTCCTTAGAGTGACAGG + Intergenic
940755971 2:157683912-157683934 CAGCTTTTCCCAACAGAAAAAGG + Intergenic
941294280 2:163716491-163716513 CTTTTTTTCCTAAAAGCTAATGG - Intronic
941553357 2:166943786-166943808 CAGTTGTTCCCCCAAGAGAAGGG + Intronic
943387311 2:187217752-187217774 GAGTTTTTCCTCAAACAGAATGG + Intergenic
943414418 2:187582820-187582842 CATTTTTTACCAAAGGAGAAAGG + Intergenic
943560077 2:189450680-189450702 AAGTTTTAACTAAAAGAGAGAGG - Intronic
945597649 2:211815421-211815443 CACCTTTTCCCAAAAGAGTAAGG + Intronic
946595239 2:221298948-221298970 CAGTCTTTCCTAAAAAATCAGGG - Intergenic
947268964 2:228312278-228312300 CAGTTCTTCCTCAAAGAAGACGG - Intergenic
948495964 2:238350188-238350210 GAGTTTTGCCACAAAGAGAAGGG + Intronic
949080721 2:242096814-242096836 CGGTTTTTCCTTCCAGAGAAAGG - Intergenic
1169737111 20:8849024-8849046 CAGTTTGTCCTGGGAGAGAATGG + Intronic
1169887452 20:10416272-10416294 AAGTTTTTCCTAAAAGCAAATGG + Intronic
1170015953 20:11782447-11782469 AAGTTTTACCTTAAAGGGAAAGG + Intergenic
1170400381 20:15976871-15976893 CACTTTATCCTCAAAGTGAAGGG + Intronic
1170470249 20:16661468-16661490 CAGTTTTTTCTAGAAGAGGGTGG + Intergenic
1170966169 20:21073624-21073646 CAGTTTTTCATAAAATAATATGG - Intergenic
1174032173 20:47638500-47638522 CATTATTTCCTAAACTAGAATGG + Intronic
1175211971 20:57364513-57364535 AAGTTTTTGCTAGAGGAGAATGG + Intronic
1175539323 20:59738385-59738407 GATTTTGTCCTAAATGAGAAGGG + Intronic
1176126528 20:63477929-63477951 CAGTTTTTTCTAAAGGACCAAGG + Intergenic
1177248429 21:18561603-18561625 CAGTTTTGTCGAAAAGAGAAGGG - Intergenic
1177751306 21:25287512-25287534 CTGTTTTGCCCAAAAGATAAGGG + Intergenic
1177785863 21:25670710-25670732 CTGTTTTTACCAAAAGAAAAGGG + Intronic
1178470551 21:32888657-32888679 CTTTTTTTCCTAAAGGACAATGG - Intergenic
1178721172 21:35010689-35010711 CATTTTTTTCTAAATGGGAATGG - Intronic
1178990701 21:37353256-37353278 TTTTTTTTCCTAAAGGAGAAGGG - Intergenic
1179213409 21:39346813-39346835 CAGTTTTCCCAAAAGGAAAAAGG - Intronic
1183518875 22:38284727-38284749 CAGGGTTTCCTAAGGGAGAATGG - Intergenic
1184851539 22:47124203-47124225 CAGTTCTTGCTAAAACACAAGGG - Intronic
950016766 3:9759936-9759958 ATGTTTTTCTTAAGAGAGAAAGG - Intronic
950030445 3:9848650-9848672 CAGTTTTGTCGAAAAGAAAAGGG - Intronic
950924246 3:16724263-16724285 TAGTTGGTGCTAAAAGAGAAAGG - Intergenic
951014747 3:17718207-17718229 AGGTTTTTCCTAAAAGAAGATGG + Intronic
951290723 3:20868884-20868906 CAGTTTTTCATAAATATGAAAGG + Intergenic
951343687 3:21520271-21520293 CTGTTTCTCCTAACAGAGAGTGG + Intronic
951359557 3:21708946-21708968 CAGTTTCTCCTTAAAGGCAAAGG + Intronic
951480785 3:23160083-23160105 GAGTGTTTCCTAAAATAGAAGGG - Intergenic
952622503 3:35362465-35362487 CAATCTTTGCTTAAAGAGAAAGG + Intergenic
952731197 3:36638069-36638091 CTGTTTTTACTTAAAGAGAAGGG - Intergenic
954086449 3:48247692-48247714 CAGCATTTCAGAAAAGAGAAGGG - Intronic
955942622 3:64160558-64160580 CTGTTTTTCCAAAATGAGACGGG - Intronic
956037825 3:65114705-65114727 CAGCTTTTCTTGAAAGTGAATGG - Intergenic
956189900 3:66598560-66598582 CTGGCTTTCCTAACAGAGAACGG + Intergenic
956812519 3:72877944-72877966 CTGTTTTTCCAAAGAGAGAAGGG + Intergenic
958417029 3:93886825-93886847 AAATTTTTCCTAAGATAGAATGG - Intronic
958583418 3:96054739-96054761 TAGTTTTTACTAAAAGTGTATGG - Intergenic
958861307 3:99447893-99447915 CAGTATTCCCTAAAAGAAAATGG + Intergenic
959140340 3:102478514-102478536 CCCTTTTTCCTAAAACAAAAAGG + Exonic
959429493 3:106235433-106235455 AAGATTTTCCTCAAAGAGAAGGG - Intergenic
959747054 3:109787756-109787778 CAACTTTTCCTAAAACAAAAAGG - Intergenic
959848927 3:111065534-111065556 CAGGTCTGCCTAAAAGAGACTGG - Intergenic
959930282 3:111973975-111973997 TTTTTTTTCCTCAAAGAGAACGG - Intronic
960003880 3:112762230-112762252 TTCTTTTTCCTAAAAGAGAGTGG + Intronic
960773666 3:121224668-121224690 CAGTTTTTGGAAAGAGAGAAAGG + Intronic
962183133 3:133229547-133229569 CAGTTTTTCCTAAATTCCAAAGG + Intronic
964026865 3:152084733-152084755 GAGTTTTTCCTAAAGCAGGAAGG - Intergenic
964275952 3:155009086-155009108 CAGTTTTTGTTATAAAAGAAGGG + Intergenic
964685398 3:159390494-159390516 AAATTTATGCTAAAAGAGAAGGG + Intronic
964706037 3:159619541-159619563 CAGTTTTCCTCAAAAGAGATGGG - Intronic
964818828 3:160747531-160747553 TAGTTGTTCTTAAAAGAAAAAGG + Intergenic
965174467 3:165313880-165313902 TAGTTTTCAATAAAAGAGAAAGG - Intergenic
965786878 3:172344655-172344677 CAGTTTTTACAACTAGAGAAGGG + Intronic
965859008 3:173124591-173124613 TTGTTTTTCTTAAAAGAAAAGGG - Intronic
966776276 3:183545288-183545310 CAGTTTTACCAAAAACACAAAGG + Intronic
967425528 3:189322943-189322965 CAGTTTTTACAAAATGTGAAGGG - Exonic
967534517 3:190587010-190587032 CAGTTTTTCAGAGAAAAGAACGG - Intronic
968665144 4:1816940-1816962 AAGTTTGTCTTAAAAGAAAAAGG + Intronic
968970531 4:3791323-3791345 CAGGTCTTCTTGAAAGAGAAGGG + Intergenic
969277236 4:6144182-6144204 CAGTTTTACCTGAATGGGAAGGG - Intronic
971001773 4:22331785-22331807 CAGTTTTTTCTAAAATAAATAGG + Intergenic
971124239 4:23735316-23735338 TACTGTTTGCTAAAAGAGAAAGG - Intergenic
971765819 4:30829808-30829830 CAGTTTGCTCTAAAATAGAAGGG + Intronic
971914852 4:32855670-32855692 CAGCTTTTCCAAAAAGAAAGTGG - Intergenic
972111709 4:35569838-35569860 CAGTTTTTTCAAAAAGAGGAAGG - Intergenic
972270698 4:37509132-37509154 CAGTTTTGTCTAATAGAAAAGGG - Intronic
972279786 4:37590749-37590771 CAGCTTCTCCTCACAGAGAAGGG - Exonic
972378850 4:38500088-38500110 CAGTTTATTCTAAAGGATAATGG + Intergenic
972663440 4:41141036-41141058 CAGTTTTTCCAAACAGTGAGTGG - Intronic
972967126 4:44524366-44524388 TAGTTTTCCCTAAAGGAGTAAGG + Intergenic
973566765 4:52196710-52196732 TAGAATTACCTAAAAGAGAAAGG + Intergenic
973653988 4:53026827-53026849 CATTTTTTCTTAAAAGGAAAAGG + Intronic
974612368 4:64232574-64232596 CGGTTTTGCCTAAATGAGAGGGG + Intergenic
974725298 4:65791292-65791314 CAGCTGTTCCTAATAGACAATGG - Intergenic
974925857 4:68296661-68296683 GAGTTTCTCCTAAGACAGAAAGG - Intergenic
975056387 4:69936614-69936636 AAGTTTTTCTTGAAAGAGTATGG + Intronic
975209506 4:71682831-71682853 TATTTTTTCAGAAAAGAGAAGGG - Intergenic
976366090 4:84233916-84233938 TAGTTTTTCCTAATAGAGAATGG - Intergenic
976389534 4:84494919-84494941 AATTTTTTCCTAAAAAATAAAGG - Intronic
976799800 4:88976174-88976196 CAGTTATTCATTAAAGAGAAAGG - Intronic
977279549 4:95022887-95022909 CAGTCTTTCTTACAACAGAACGG - Intronic
977377507 4:96224851-96224873 CACTTTATCCAACAAGAGAAAGG + Intergenic
977778698 4:100954787-100954809 CAGTTTTCCTTTAAATAGAAGGG - Intergenic
978306509 4:107334315-107334337 CAGTTTTACAAAAAAGAGAAGGG + Intergenic
979634128 4:122938161-122938183 CACTTTGTCCGAAAAGAGAGGGG + Exonic
979709511 4:123761737-123761759 CAGTTGTTCTTAAAAGTGAGAGG + Intergenic
980135660 4:128856250-128856272 CAGTTTTTCCTCAAGGAAAAAGG - Intronic
980667935 4:135963123-135963145 CAGTCTCTCCTCAGAGAGAAGGG + Intergenic
981773124 4:148333286-148333308 TAGTTTTTCATAACATAGAAAGG - Intronic
981929343 4:150173123-150173145 CAGTTTTTGCTAAAAGTAGAGGG + Intronic
982802271 4:159720083-159720105 ATGTTTTTCCTAAAAAAGATAGG + Intergenic
983528928 4:168789844-168789866 TACTTTTTCCTTAAAGAGAGAGG - Intronic
983991768 4:174128369-174128391 CAATTTTTCCTAAAAAAAAATGG - Intergenic
984060534 4:174984327-174984349 CAGTTTTGTCGAAAAGAAAAGGG - Intergenic
984876852 4:184376536-184376558 CAAGTATTCCTATAAGAGAAAGG + Intergenic
985063672 4:186102066-186102088 CAGTTGCTCCTGAAGGAGAAGGG + Intergenic
985461068 4:190107269-190107291 CAGTTTTGTCAAAAAGAAAAGGG - Intergenic
986503452 5:8425898-8425920 CAGTATTTCCCAACAGAGGAGGG - Intergenic
987738587 5:21875840-21875862 TATTTTCTCCTAAGAGAGAATGG + Intronic
988158344 5:27484912-27484934 AAGTGTTTCCTGAAAAAGAAAGG - Intergenic
988205777 5:28131681-28131703 CATTTTGTCTTACAAGAGAAAGG + Intergenic
988595844 5:32589879-32589901 CAATTTTAGCTAAAAGAAAAGGG + Intronic
989071751 5:37519141-37519163 CAGTTTTGTCGAAAAGAAAAGGG - Intronic
989100210 5:37816014-37816036 CAGTGCTTCCTAGAAGAGAGCGG - Exonic
989214238 5:38887671-38887693 CAGTTTTACATAAAAGAGTATGG - Intronic
989513698 5:42317757-42317779 CAGTTTTATCATAAAGAGAATGG - Intergenic
989693302 5:44170735-44170757 CAGTTTCTCTTCAAAGACAATGG - Intergenic
989836573 5:46001010-46001032 CAGTTTTGTCGAAAAGAAAATGG - Intergenic
991174069 5:63665492-63665514 GATATTTTCCTAAAAGATAAAGG + Intergenic
992892556 5:81217452-81217474 CAATTTCTCCAAAATGAGAATGG + Exonic
992951089 5:81858456-81858478 CATTTCTTACTTAAAGAGAAAGG - Intergenic
992958606 5:81936431-81936453 CTCTTTTTCATAAAAAAGAAGGG - Intergenic
993002949 5:82400733-82400755 CATGTTTTTCAAAAAGAGAATGG - Intergenic
993330980 5:86599497-86599519 GAGTTTATCCTAAAGAAGAAAGG - Intergenic
993443496 5:87983442-87983464 GAGTTTGTTCTAAAAGAGTAGGG - Intergenic
993478145 5:88389875-88389897 CACTTTCTCACAAAAGAGAATGG - Intergenic
993604020 5:89964972-89964994 CAATTTTTCCAAAAAGAAGATGG + Intergenic
993696185 5:91064527-91064549 CAGTTTTTCCTAAACTGGACTGG - Intronic
994377757 5:99034518-99034540 AAGTTTATCCTGAAAGATAAAGG - Intergenic
994907551 5:105859751-105859773 CAGTTTTGTCTAATAGAAAAGGG + Intergenic
995101477 5:108312343-108312365 CATTTTTTTTTAACAGAGAAAGG - Intronic
995606687 5:113864497-113864519 CATATTTTTCCAAAAGAGAATGG + Intergenic
995889354 5:116933743-116933765 CAGTTTATCCAAAAAGAGGTTGG - Intergenic
997304592 5:132828243-132828265 TGGTGTTTCCTAAAAGGGAAAGG + Intronic
997548222 5:134729114-134729136 CACTTTTTACTTAAAGAGACAGG - Intergenic
997857448 5:137384789-137384811 TAGTTGTCCTTAAAAGAGAAAGG - Intronic
998404834 5:141868470-141868492 CAGTTTTTCCCCTAAGTGAAGGG + Intronic
1000434599 5:161192693-161192715 CTGTTCTTCCTAAAATAGCATGG - Intergenic
1001343606 5:170869680-170869702 CTGGTATTCCTATAAGAGAAAGG - Intronic
1002427167 5:179183221-179183243 CAGTTTTTCTTAAGAGAGAAGGG + Intronic
1003601608 6:7522632-7522654 GAGTTTTTCCTGAATGAGGATGG + Intergenic
1003615424 6:7651003-7651025 TTGTTTCTCCTAAAATAGAAAGG + Intergenic
1005284224 6:24307628-24307650 CACTTTTTGATAAATGAGAAGGG + Intronic
1005448794 6:25953305-25953327 CAGTTTTCACTAAGAGAGAGAGG + Intergenic
1005634894 6:27744037-27744059 CACTCTTTCCTAATTGAGAAGGG - Intergenic
1006498736 6:34443530-34443552 CTATTTTTTCTAAAAGAGACAGG - Intergenic
1007992555 6:46271849-46271871 CAGTTAAACCTAAAAGAGACTGG - Intronic
1008430402 6:51410160-51410182 TTGTTTTTCCTAAAAATGAAAGG - Intergenic
1009555339 6:65156840-65156862 CAGTTTCTCATCAAAGATAATGG + Intronic
1009844699 6:69121459-69121481 CAGTTTTGTCGAAAAGAAAAGGG - Intronic
1010568278 6:77445211-77445233 CAGTTTTTCATAAATCAAAAAGG + Intergenic
1010693587 6:78941953-78941975 CATTTTTTTCTACAACAGAAAGG - Intronic
1010760814 6:79720846-79720868 TTGTTTTTCCTAAAAGAGTGAGG + Intergenic
1010924917 6:81733247-81733269 CTGTCTTTCCTGAAAGAAAATGG + Intronic
1011860468 6:91748778-91748800 CAGTTTATCTTAAAATAGAGAGG + Intergenic
1012166209 6:95955695-95955717 CATTTTTTAAAAAAAGAGAAAGG + Intergenic
1012623543 6:101378378-101378400 CATTTTTACCTAACACAGAATGG + Intergenic
1013277474 6:108599652-108599674 GATTTTTTCTTAAAGGAGAATGG - Intronic
1014732291 6:125046872-125046894 CAGTTATACCTGATAGAGAATGG - Intronic
1014875290 6:126651116-126651138 CAGTGTTCCTGAAAAGAGAAAGG - Intergenic
1015564040 6:134547713-134547735 AAGTTTTTTTTAAAAGTGAAAGG - Intergenic
1015704472 6:136072987-136073009 GGGTTTCTCCAAAAAGAGAAGGG - Intronic
1015847639 6:137537417-137537439 AAGTTTTTCCTTATTGAGAAGGG - Intergenic
1016135976 6:140543592-140543614 CAGATTTTCCTGAAAATGAAAGG + Intergenic
1016603753 6:145893385-145893407 AAGGTTCTCCTAAAAAAGAAAGG + Exonic
1016801940 6:148177856-148177878 AGGTTTTTCCTAAATGAGGAAGG - Intergenic
1017855591 6:158348629-158348651 CAGTTTTGTCAAAAAGAAAAGGG - Intronic
1017859914 6:158386643-158386665 CAGATTTTCCTTAACTAGAAAGG + Intronic
1018019622 6:159748272-159748294 TTGTTTTTCCTAAAAATGAAAGG + Exonic
1018552322 6:165011940-165011962 GATTTTTTTCTAGAAGAGAAAGG - Intergenic
1018676529 6:166226856-166226878 CACTTTTTCCTAAAACAGCGTGG - Intergenic
1021049803 7:15968877-15968899 CAGTAGTTCATAAAACAGAATGG + Intergenic
1021233120 7:18109437-18109459 CAGTGTTTCCTAAAGTAGATGGG + Intronic
1022218960 7:28293036-28293058 CAATATTTCCTGAAAGATAATGG + Intergenic
1023018532 7:35988718-35988740 CAGTTCCTCCAAAAAGAGACTGG - Intergenic
1023816394 7:43953586-43953608 CTGTTTTGCCTAAAAGAAAGAGG - Exonic
1023953916 7:44870780-44870802 CAGTTTTGTCAAAAAGAAAAGGG - Intergenic
1024264980 7:47599530-47599552 CAGTCTTTTATAATAGAGAAAGG + Intergenic
1024601349 7:50984436-50984458 CAGATTTTCCCAAATGAAAAGGG + Intergenic
1026112704 7:67470845-67470867 AACTTCTTCCTAAAAGACAATGG - Intergenic
1027641995 7:80747025-80747047 CATGTTTTCTTAAAATAGAAAGG + Intronic
1027955913 7:84879589-84879611 CATATTTTCCTTAAAGATAAGGG - Intergenic
1028292332 7:89080856-89080878 CACTTTTTCCTAAAAATGTAGGG - Intronic
1028293135 7:89092942-89092964 CCCTTTTTCCTGAAAGAGCAAGG + Intronic
1028669060 7:93380200-93380222 CAGTTTCTCCAAAAATAGGAAGG - Intergenic
1030113580 7:106046733-106046755 CAGTTTTTCTTAGGCGAGAATGG + Intergenic
1030608488 7:111663820-111663842 CAGTTTTCAATAAAATAGAAAGG - Intergenic
1030941042 7:115650360-115650382 CAGGTTTTCGTAAAAGAGCTAGG + Intergenic
1031268230 7:119610117-119610139 CAGTTGTTCATAGATGAGAATGG - Intergenic
1031799786 7:126227941-126227963 CAGTTTCTCAGAAAATAGAAAGG + Intergenic
1031939145 7:127768883-127768905 CAATTGTACTTAAAAGAGAAAGG - Intronic
1032329220 7:130962255-130962277 CAGTTTTTTCTACAATAGTAAGG - Intergenic
1033185923 7:139226504-139226526 CAGTTTTGTCGAAAAGAAAAGGG + Intergenic
1033886787 7:145959171-145959193 CAATTTTTGACAAAAGAGAATGG - Intergenic
1034077775 7:148249309-148249331 CAGTGTTCCCTAAAAGCCAAGGG - Intronic
1035149213 7:156853322-156853344 CATTTTTTTTTAAAAGAGAAAGG - Intronic
1035193219 7:157190710-157190732 AATTTTTTCCTAAAAGCAAAGGG - Intronic
1035495886 7:159325729-159325751 AAGTTTTGACTAAAAGAGTATGG - Intergenic
1035633031 8:1122520-1122542 CAGTTTATGATAAAAGAAAAAGG - Intergenic
1035889923 8:3332308-3332330 AAGCTTTTCCTAGCAGAGAAGGG + Intronic
1036672561 8:10801828-10801850 CAGATTTGCCTAAAAGATAAAGG + Intronic
1038083434 8:24166041-24166063 CAGTTTTTCCTGAAGGTGGAGGG + Intergenic
1038610110 8:29053010-29053032 CAGTATCTCCTGAATGAGAAAGG - Exonic
1038769569 8:30464740-30464762 CAGATTATGCAAAAAGAGAAAGG + Intronic
1039110929 8:34040228-34040250 CAGTTTCTTCTAACAGTGAATGG + Intergenic
1039377270 8:37047701-37047723 CAAATATTCTTAAAAGAGAAAGG + Intergenic
1039951352 8:42175224-42175246 CAGTTTTTCCAAAATCAGAGTGG - Exonic
1040409317 8:47138219-47138241 CGGTTTTGTCTAAAAGAAAAAGG + Intergenic
1040457137 8:47610159-47610181 CTTTTGTTCCTAAAAGAGACTGG + Intronic
1041062621 8:54050499-54050521 CAGCTTTTCCTAAGACTGAATGG + Intronic
1041106589 8:54450212-54450234 CAATTTTCCCAAAAAAAGAAGGG - Intergenic
1041551467 8:59106558-59106580 CAATTTTTCCAAAAAGAGAAAGG - Intronic
1041963939 8:63652094-63652116 CAGATTTTCCTTAAAGACAATGG + Intergenic
1042728104 8:71901204-71901226 CATCTTTTACTCAAAGAGAAAGG - Intronic
1042841306 8:73126624-73126646 CAGTTTCTCCTGAGAAAGAAAGG + Intergenic
1043209028 8:77487379-77487401 CAGTTTTACCTAACACAGATGGG - Intergenic
1043300486 8:78724768-78724790 CAGTGTTTACTAAAAGGGAACGG - Intronic
1043503653 8:80881351-80881373 CACTGTGTGCTAAAAGAGAAAGG + Intergenic
1043541867 8:81272880-81272902 CAGTTTCTACTGAAAGACAAGGG + Intergenic
1043657943 8:82695884-82695906 CAGTTTCTTTTAAAAGATAATGG - Intergenic
1043801131 8:84610998-84611020 TAGTTGTTTCTAAAGGAGAATGG + Intronic
1045710756 8:104981052-104981074 GAGTTTTTCTTTAAAGGGAAAGG + Intronic
1045880804 8:107037499-107037521 CAGTTTTGCTTAAAATGGAAAGG + Intergenic
1045999578 8:108403122-108403144 CAGCTATTCCCACAAGAGAAGGG + Intronic
1046799999 8:118415710-118415732 CTGTTTATCCTAGAGGAGAATGG - Intronic
1047354727 8:124109515-124109537 CTGCTTTTCGTTAAAGAGAAAGG + Intronic
1048012894 8:130472833-130472855 CAGATTTACCTAACAAAGAATGG + Intergenic
1048902244 8:139050097-139050119 CAGTTTTGTCAAAAAGAAAAGGG + Intergenic
1050304545 9:4295028-4295050 CACTTTTTCCTAGTAGAGAAAGG - Intronic
1050517410 9:6459244-6459266 CCATTTTCCCTGAAAGAGAAAGG - Intronic
1051343226 9:16129960-16129982 GTGTTTTTCATAAAAGAGGAAGG + Intergenic
1052067148 9:24036039-24036061 CAGATGTTCCTAAAAGAAAAGGG + Intergenic
1052797349 9:32935311-32935333 AAATTATACCTAAAAGAGAATGG + Intergenic
1053051867 9:34968647-34968669 CAGTGTTTCCGAAAAGAAGATGG + Intronic
1055241419 9:74190935-74190957 CACTCTTGCCCAAAAGAGAAAGG + Intergenic
1057838350 9:98464659-98464681 CAGTTTTGTCGAAAAGAAAAGGG + Intronic
1058119584 9:101124017-101124039 CTGTTTTACAAAAAAGAGAAGGG - Intronic
1058240028 9:102546600-102546622 TTGTTTTTCCTAGAAGAGTAAGG + Intergenic
1058952038 9:109913065-109913087 ATGTTGTTCCTAAAAGAAAAGGG + Intronic
1059866872 9:118524449-118524471 CAGTTTTTGCAGAAATAGAAAGG + Intergenic
1060680910 9:125563399-125563421 CTGTTTTTCCGATAAGAAAATGG - Intronic
1061221027 9:129252261-129252283 CAGTTATTCAAAAAAGAGAGGGG + Intergenic
1061633854 9:131892826-131892848 TGGTTTTTCCAAAAAGAAAAAGG + Intronic
1062727370 9:138083245-138083267 CAGTTTTGCCTCAAGGATAAAGG - Intronic
1186242076 X:7579908-7579930 AAGTTCTTTATAAAAGAGAATGG - Intergenic
1186443921 X:9609598-9609620 CAATTTATCCTAAAGGAAAATGG - Intronic
1186857476 X:13639981-13640003 CAGATTTTCCCAAATGAGGATGG + Intergenic
1188226695 X:27608553-27608575 CAGTTTCTCCTAAAATTCAAAGG + Intronic
1188261521 X:28030462-28030484 CAGTTTTTCCTCAAAATGTAGGG - Intergenic
1188448958 X:30288888-30288910 CAATCTTATCTAAAAGAGAAAGG + Intergenic
1188820382 X:34767686-34767708 TAGTTTTTCCTAAAAGGGCTTGG + Intergenic
1188822335 X:34790524-34790546 CAAATTTTCCTAAAATAGCAAGG + Intergenic
1189616372 X:42788728-42788750 CAGTTTTTTCTACAAAACAAAGG - Intergenic
1190852468 X:54259025-54259047 CAGCTTTTCCTAGAACAGAATGG + Intronic
1191699313 X:64022405-64022427 CAGTCTTTCCTAAGAGATTAAGG - Intergenic
1192134547 X:68584801-68584823 CTGTTTTTCCTAATATAGAAAGG + Intergenic
1192505253 X:71677078-71677100 CAGTTTTGTCGAAAAGAAAAGGG + Intergenic
1192664211 X:73070079-73070101 CAGTTTTGTCGAAAAGAAAAGGG + Intergenic
1193102818 X:77635321-77635343 AACTTTATCCAAAAAGAGAATGG + Intronic
1194885347 X:99308855-99308877 TAGTGGTTCCTAAAAGAGAAAGG - Intergenic
1196376928 X:115043448-115043470 CATTTATTCCCAAAAGGGAATGG + Intergenic
1196981661 X:121221202-121221224 CAGTTTTTAGTAAAAGAGCTAGG + Intergenic
1197780643 X:130156343-130156365 AAATTTTTCCAAAAGGAGAAAGG + Intronic
1199257299 X:145731437-145731459 CAGCTTTTACCAATAGAGAAGGG + Intergenic
1200392478 X:155957895-155957917 CAGTGTTTCCTGAAAAAGAAAGG - Intergenic
1200752502 Y:6959419-6959441 CAGTTTTGTCAAAAAGAAAAGGG - Intronic
1200801657 Y:7392724-7392746 TAGTCCTTCCTGAAAGAGAATGG - Intergenic
1202029058 Y:20552796-20552818 CGGTTTTGCCGAAAAGAAAAGGG + Intergenic