ID: 1066413755

View in Genome Browser
Species Human (GRCh38)
Location 10:35199647-35199669
Sequence CAGTCTGACCTGGGTGTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066413755_1066413761 17 Left 1066413755 10:35199647-35199669 CCAACTACACCCAGGTCAGACTG 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1066413761 10:35199687-35199709 TTTACAAAGCTAGCAAGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066413755 Original CRISPR CAGTCTGACCTGGGTGTAGT TGG (reversed) Intronic
905182401 1:36175384-36175406 CAGACTGGCCTGGGTGCTGTGGG + Intronic
908294277 1:62697843-62697865 CATCCTTACCTGGCTGTAGTAGG - Intergenic
909659059 1:78062317-78062339 CAGTGTGTTCTGGGTGTGGTTGG + Intronic
913219328 1:116646729-116646751 CAGGCTGTCCTGGCTGTAGCCGG - Intronic
913386101 1:118259877-118259899 CAGTCTCATGTGGGTGAAGTGGG + Intergenic
913709927 1:121472853-121472875 CAGTGTGACCTGGATGTAAGAGG - Intergenic
915842234 1:159223632-159223654 CAGTCTGAGCTGTTTGTTGTTGG + Intergenic
921671356 1:217927310-217927332 CAGTGTGTCCTGGGAGTGGTAGG + Intergenic
1066413755 10:35199647-35199669 CAGTCTGACCTGGGTGTAGTTGG - Intronic
1067792979 10:49301718-49301740 CTGTCTGACCTGGGCTTAGAAGG - Intronic
1069605022 10:69733396-69733418 CAGTGTGGCTGGGGTGTAGTTGG + Intergenic
1070692285 10:78536231-78536253 CATTCTTGCCTGGGTGTTGTAGG + Intergenic
1075205481 10:120444271-120444293 CAGTCTCATCTGGGGGTGGTGGG - Intergenic
1076865486 10:133164365-133164387 CAGTCTGACCTTGTTGTGGCTGG - Intronic
1076924696 10:133476430-133476452 GAGTCTGGCCTGGTGGTAGTTGG + Intergenic
1076981353 11:206652-206674 CACTCTGCCCTGGGTGTTGCAGG - Intronic
1081602287 11:44503716-44503738 CAGTCTCCCCAGGGTGTGGTGGG + Intergenic
1081740465 11:45435972-45435994 CAGTCTGGGCTGGGTGCAGTGGG - Intergenic
1083256433 11:61498889-61498911 GAATCTGACGTGGGTGTACTTGG + Intergenic
1083677171 11:64332581-64332603 CACTCTGACCTGGCTCTGGTTGG + Intergenic
1084547866 11:69823336-69823358 CAGGCTGCCCTCGGTGTTGTGGG - Intergenic
1084641929 11:70431372-70431394 CAGTGTGGCGTGGGTGTAGAGGG + Intronic
1085314547 11:75536494-75536516 CAGGTTGACTTGGGTGTAGAGGG - Intergenic
1090007029 11:123011782-123011804 GACTCTGACCTGGCTGCAGTAGG - Intergenic
1092966158 12:13645345-13645367 CTGTCTTATCTGGGTGTGGTTGG + Intronic
1094581840 12:31740502-31740524 CAGTCTCACCTGGGTTCAGATGG + Intergenic
1096557980 12:52415483-52415505 CATTCTGCCCTGGGAGTCGTTGG - Intergenic
1099158043 12:79204304-79204326 CAGTCTGAACTGTGTATAGATGG + Intronic
1100320008 12:93481897-93481919 CAGTCTGTGCTGGGTTAAGTAGG - Intronic
1100649309 12:96567389-96567411 AAGTCTGTCCTGGGAGTATTAGG + Intronic
1101144056 12:101824169-101824191 CAGGCAGCCCTGGGTCTAGTTGG + Intronic
1101652360 12:106689135-106689157 CAGTCTCACCTGGGTCTGGTAGG + Intronic
1102697561 12:114812009-114812031 TAGTCTTGCCTGGGTGTAGCAGG + Intergenic
1103117755 12:118351905-118351927 CAGTCTGGCCTGGGTGAAAGAGG - Intronic
1103226358 12:119291352-119291374 CAGTCTGATCTGGGGGTGATGGG - Intergenic
1106145260 13:27044418-27044440 CTGTCTGACCAGGGTGCAGCAGG - Intergenic
1110495150 13:76159664-76159686 CAGACTGACCTGGGTTTAAATGG - Intergenic
1112463321 13:99621915-99621937 AAGTCTGACCTAGGTTTTGTGGG + Intronic
1116221397 14:42092679-42092701 GAGTCTTCCCTGGGTGTAGTAGG - Intergenic
1117643365 14:57824347-57824369 CAGTCAGAGCTTGGTCTAGTTGG + Intronic
1119446025 14:74664023-74664045 CAGTCTGACCCAGGAGGAGTTGG - Exonic
1121733319 14:96201566-96201588 CTGTCTGACCTGTGTGTAACTGG + Intergenic
1124242103 15:28037287-28037309 CCTCCTGACCTGGGTGTAGAGGG - Intronic
1126139883 15:45428984-45429006 CATTCTGTCCTGCTTGTAGTAGG - Intergenic
1127843060 15:62846967-62846989 CAGGCTGACCTGGGGGTGGTGGG + Intergenic
1129109728 15:73330364-73330386 GAGTCTGCCTTGGGGGTAGTGGG - Intronic
1129637890 15:77341613-77341635 CAGCCTGACCTGGTGGGAGTAGG - Intronic
1129918511 15:79296693-79296715 CTGTCTGTCCTGTGTGTTGTAGG + Exonic
1129946872 15:79546154-79546176 CAGTCTGACTTGGTTATGGTGGG + Intergenic
1130751445 15:86717361-86717383 CATTCTCCCCTGGGTTTAGTAGG - Intronic
1131325486 15:91439546-91439568 CAGTCTGATCTGGGGGTGATGGG + Intergenic
1139851741 16:69954560-69954582 CACACTCACCTGCGTGTAGTGGG - Exonic
1139880716 16:70177467-70177489 CACACTCACCTGCGTGTAGTGGG - Exonic
1140371793 16:74418050-74418072 CACACTCACCTGCGTGTAGTGGG + Exonic
1144687762 17:17237309-17237331 CAGTCAGACCTCGGAGTTGTAGG - Intergenic
1146722928 17:35136066-35136088 CATTCTGAGCTGGGTCTAGAAGG + Intronic
1151681457 17:75624903-75624925 CAGGCTGACCTGGCTGTAGTGGG - Intergenic
1152128303 17:78460633-78460655 CATTCTGACCTGAGCGTTGTGGG - Intronic
1155096622 18:22561929-22561951 CAGACAGACCTGGGTTCAGTGGG - Intergenic
1162087881 19:8259504-8259526 CAATCTGACCTAGGTGTTCTGGG + Intronic
1162136606 19:8559288-8559310 CAGTCTCTCCTGGGGGTACTGGG + Intronic
1162453637 19:10769422-10769444 CAGGCAGACCTGGGAGTAGGAGG + Intronic
1163193444 19:15696804-15696826 CAGGCTGAGCTGGGTGCAGTTGG + Intronic
1165282264 19:34807462-34807484 CAGTCTTACCTCTGTGCAGTAGG + Intergenic
1166594862 19:44036601-44036623 CATTATGAATTGGGTGTAGTTGG + Intergenic
924968509 2:100953-100975 CATTCTGACCAGGATGGAGTTGG - Intergenic
933584041 2:84160805-84160827 CAGTCTGTCCAGGGTGCAGCTGG + Intergenic
937985295 2:127635603-127635625 CAGTCCGTCCTGGATGGAGTGGG + Intronic
939310645 2:140470609-140470631 CAGTCTGGCCTGGGTGAAAGAGG + Intronic
942340043 2:174934244-174934266 CAGTCTCATCTGGGGGTAATGGG + Intronic
943506103 2:188759745-188759767 CAGTCTAACATAGGTGTAATAGG + Intronic
944668892 2:201979187-201979209 CAGTCTGAGCAGGGTGTGGCAGG + Intergenic
948655017 2:239471132-239471154 CATTCTATCCTGGGTGTTGTGGG - Intergenic
949009130 2:241668441-241668463 CAGTGTGATGTGGGTGCAGTGGG + Intronic
1168832198 20:852277-852299 CAGTCTGGCCTGGGCTTAGCTGG + Intronic
1172881486 20:38202704-38202726 CAGCCTGACCTGGGGGTGGAGGG + Intergenic
1175423619 20:58851075-58851097 CCGTCTTGCGTGGGTGTAGTTGG + Intronic
1179632546 21:42687785-42687807 CAGCCTGACCAAGGTGTGGTGGG - Intronic
1180136153 21:45863298-45863320 CAGTCTGCCATGGGTGGCGTAGG - Intronic
1181644682 22:24224987-24225009 CAGCCTCACCTGGCTGAAGTTGG + Exonic
1184709452 22:46240018-46240040 CAGTCTTAGCTGGGTGCATTGGG - Exonic
1185082545 22:48717956-48717978 CCGTCTGTCCTGCGTGTGGTGGG + Intronic
1185410584 22:50679415-50679437 CAGTCGCACCTGGTTGTAGAGGG - Intergenic
950549716 3:13658868-13658890 CAGTCTGGCATGGGTGTGGGCGG - Intergenic
951934715 3:28009454-28009476 CATTCTGACCTGCTTGTAGGTGG - Intergenic
955319552 3:57964513-57964535 CTGTCTGTCCTGGGTTTTGTGGG - Intergenic
955984963 3:64563116-64563138 CATTATGTCCTGGGTGTAATGGG + Intronic
962634910 3:137320654-137320676 GAGGCTGACCTGTGTGTGGTAGG + Intergenic
963063758 3:141246090-141246112 AAGGATGACCTGGGTGTAATGGG + Intronic
965622536 3:170655668-170655690 CAGTCTAGCCTGGATGTAGCAGG + Intronic
976154147 4:82124723-82124745 CAGTCTGACCTCTGGGTAGGAGG + Intergenic
980772796 4:137399149-137399171 CGGACTGAAATGGGTGTAGTTGG + Intergenic
987443476 5:17986513-17986535 CAGTTGGAAATGGGTGTAGTGGG + Intergenic
988798427 5:34673942-34673964 CAGAATGACCTGGTTGGAGTGGG + Intronic
997119911 5:131163543-131163565 GACTCTGACCTGGGAGTAATGGG - Intronic
997791851 5:136769074-136769096 CAGCCAGACCTGGGTTAAGTGGG + Intergenic
997838955 5:137220560-137220582 GAGTCAGACCTGGGTGATGTGGG - Intronic
1001933192 5:175687419-175687441 CAGCCTGCCCTGGGTGGGGTGGG + Intergenic
1002323817 5:178392311-178392333 CAATCTGCCCTGGGTGTCCTCGG + Intronic
1002986420 6:2193131-2193153 CAGACTGTCCTGGGTGTCTTAGG - Intronic
1006926048 6:37655691-37655713 CATCCTGACCTGAGTGTAGAGGG + Exonic
1011342297 6:86330182-86330204 CAGTCTAACATAGGTGTAATTGG + Intergenic
1015150969 6:130036931-130036953 CAGTCTGACCTGGGTTCAAATGG + Intronic
1017085730 6:150711043-150711065 AAGTCTGACTTGGGAGGAGTGGG + Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1018419152 6:163626968-163626990 CCATCTGCCCTGGGGGTAGTGGG + Intergenic
1018726602 6:166617639-166617661 CAGTAGGACTTGGGTGTAGAGGG - Intronic
1020718409 7:11709331-11709353 CAGGCTGATCTGAGTATAGTAGG - Intronic
1020979172 7:15046474-15046496 CAGTCTGTCCTCTGTTTAGTGGG - Intergenic
1026776010 7:73231550-73231572 CAAGCTCACCTGGGTGTAGGGGG + Intergenic
1027016867 7:74784921-74784943 CAAGCTCACCTGGGTGTAGGGGG + Intronic
1027071160 7:75161015-75161037 CAAGCTCACCTGGGTGTAGGGGG - Intergenic
1029884819 7:103857467-103857489 CAACCTCACCTGGGTGTAGAGGG + Intronic
1034271248 7:149804298-149804320 CAGGCTGGCCTGGGTGGAGCAGG + Intergenic
1038443652 8:27588303-27588325 CAGCCCTACCTGGGTGCAGTGGG - Intergenic
1038777443 8:30543737-30543759 CAGCCTGACCTGGGTGGAATTGG + Intronic
1039759361 8:40558124-40558146 CAGGCTGCCATGGGTGTGGTGGG + Intronic
1039765500 8:40623992-40624014 CAGTATGACCTGGAATTAGTAGG - Intronic
1039928925 8:41965043-41965065 CAGTGTGACTTGCATGTAGTAGG - Intronic
1041345984 8:56898461-56898483 TAGTCTGACCTGTGTTTAGCAGG - Intergenic
1042544040 8:69935017-69935039 CATGCTGGCCTCGGTGTAGTTGG - Intergenic
1046698113 8:117365602-117365624 CAGTCAGACTTGAGAGTAGTGGG + Intergenic
1049341469 8:142114834-142114856 CAGTCAGAGCTGGGTGGTGTTGG - Intergenic
1049393400 8:142383411-142383433 CACTCTGTCCTGGGTGTGCTTGG - Intronic
1051911607 9:22159049-22159071 CACTCTGTCCTGGGTGTCTTTGG + Intergenic
1053527623 9:38845785-38845807 CTGACTGTCCTGAGTGTAGTAGG - Intergenic
1054199849 9:62070214-62070236 CTGACTGTCCTGAGTGTAGTAGG - Intergenic
1054638507 9:67518143-67518165 CTGACTGTCCTGAGTGTAGTAGG + Intergenic
1055023311 9:71692866-71692888 CACTCTGGCCTGGGTGAAGAGGG + Intronic
1061290859 9:129649625-129649647 CAGGCTGACCCGAGTTTAGTAGG - Intergenic
1189308239 X:40003291-40003313 CAGGCTGATCTGGGTGGAGGAGG + Intergenic
1200326294 X:155243362-155243384 CAGTCTAAGATGGGTGTACTTGG - Intergenic