ID: 1066417840

View in Genome Browser
Species Human (GRCh38)
Location 10:35237790-35237812
Sequence CTAGTATCCCACACATTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066417838_1066417840 17 Left 1066417838 10:35237750-35237772 CCACAGATGATAAAAGATGGCGT No data
Right 1066417840 10:35237790-35237812 CTAGTATCCCACACATTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066417840 Original CRISPR CTAGTATCCCACACATTTAT GGG Intergenic
No off target data available for this crispr