ID: 1066419693

View in Genome Browser
Species Human (GRCh38)
Location 10:35253334-35253356
Sequence GCTCGCTTGAGCCCAGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066419693_1066419700 14 Left 1066419693 10:35253334-35253356 CCAGCTCCTGGGCTCAAGCGAGC No data
Right 1066419700 10:35253371-35253393 TCCTGTGTAGCTGTGACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066419693 Original CRISPR GCTCGCTTGAGCCCAGGAGC TGG (reversed) Intronic