ID: 1066421374

View in Genome Browser
Species Human (GRCh38)
Location 10:35267636-35267658
Sequence TGTCACAAGAGGGAGCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066421374_1066421377 9 Left 1066421374 10:35267636-35267658 CCTGGTTGCTCCCTCTTGTGACA 0: 1
1: 0
2: 2
3: 10
4: 201
Right 1066421377 10:35267668-35267690 GCTTCCAAGTATCGATTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066421374 Original CRISPR TGTCACAAGAGGGAGCAACC AGG (reversed) Intronic
900119514 1:1042485-1042507 TGTCCCAAGAGTGAGGACCCTGG - Intronic
900562049 1:3312074-3312096 TGTCGCATGGGGGAGCAGCCGGG - Intronic
902650271 1:17832801-17832823 TGTCTCCAGTGGGAGCAACATGG - Intergenic
902715762 1:18271678-18271700 TGTCTCTAGAAGGAGCAACATGG + Intronic
904287552 1:29461955-29461977 TCTCTCAGGAGGGATCAACCAGG + Intergenic
905001129 1:34671095-34671117 TGCCAACAGAGGGAGGAACCTGG - Intergenic
914710339 1:150207535-150207557 TGTCACTAGAGATAGCAAACTGG - Intergenic
914750458 1:150531596-150531618 TGTCACTAGAGATAGCAATCTGG - Intergenic
915105309 1:153531739-153531761 AGTGACAAGAGGGAGCTACAGGG - Intergenic
916806817 1:168267880-168267902 TGACAAAAAAGGGAGCTACCTGG - Intergenic
917456769 1:175192682-175192704 TGTCAGACGGGGCAGCAACCAGG - Exonic
919495743 1:198265679-198265701 TGTCACTAGAGGTAGCAGTCTGG + Intronic
920340312 1:205271554-205271576 TGCCTCAAGAGGGAGCCAGCTGG + Intronic
921027890 1:211305184-211305206 TGTCACAGGAGGGTGCCAGCAGG + Intronic
1062875393 10:939267-939289 TGGCACAGGAGGGAGCAGCCAGG + Intergenic
1063798146 10:9536780-9536802 TGTTACAACATGGATCAACCTGG - Intergenic
1066421374 10:35267636-35267658 TGTCACAAGAGGGAGCAACCAGG - Intronic
1067154127 10:43760653-43760675 TGGCTGAAGAGGGAGCAAACAGG + Intergenic
1069075099 10:64030928-64030950 TGTCTTAAGATGGTGCAACCCGG - Intergenic
1072708726 10:97701591-97701613 TGTCAGTAGAGGGAGCTAGCGGG + Intergenic
1073084027 10:100876954-100876976 GGTCACAAGGGGGAGAAATCAGG + Intergenic
1074437566 10:113446911-113446933 TGTCACTAGAGAGAGCAAACTGG + Intergenic
1075160169 10:120017011-120017033 TGTGACAACAGGGATGAACCTGG + Intergenic
1076279414 10:129232935-129232957 TGTGGCCAGAGGGAGCACCCGGG - Intergenic
1077880769 11:6347827-6347849 TGTGACAATATGGAGAAACCTGG + Intergenic
1078741322 11:14068991-14069013 TGTCACCATTGGGAGAAACCAGG + Intronic
1079280595 11:19083583-19083605 AGTCAGAAAAGGGAGGAACCTGG + Intergenic
1081857091 11:46310815-46310837 TGTCAGATGAGGCAGCACCCAGG + Intronic
1083087734 11:60168095-60168117 TGTCCCAAGAGGTAGCCCCCTGG + Intergenic
1083914761 11:65734472-65734494 TGCCACAACAGGGATTAACCTGG + Intergenic
1086640157 11:89144144-89144166 TGTGACAACATGGAGGAACCTGG + Intergenic
1087833952 11:102851082-102851104 TGTCACTAGAGGTAACAATCTGG + Intergenic
1087876727 11:103367910-103367932 TGTGACAACACGGAGGAACCTGG - Intronic
1087890037 11:103527545-103527567 TGACACAACAGGAAGCAAACAGG - Intergenic
1089567657 11:119380500-119380522 GGTCACAAGAGGAAGGAACGGGG + Intronic
1090131276 11:124145121-124145143 TGTCACTAGATGGAGTTACCTGG - Intronic
1096449727 12:51728381-51728403 TGTCATCAGAGACAGCAACCTGG - Intronic
1097361320 12:58661654-58661676 TGGCAAAAGAGGGAGCAAGAGGG - Intronic
1100535334 12:95503577-95503599 TGTGACCAGAAGCAGCAACCAGG + Intronic
1100780659 12:98022726-98022748 AGTCAAAAAAGGGAGCAACTGGG - Intergenic
1101111752 12:101493136-101493158 TGTGACAACATGGAGGAACCTGG - Intergenic
1105633421 13:22194535-22194557 TGTCAAAAGAAGGAGCCATCTGG + Intergenic
1110730721 13:78876385-78876407 TGTCACATGGGGCAGCCACCTGG + Intergenic
1111593246 13:90377312-90377334 TATAAGAAGAGGGAGAAACCAGG - Intergenic
1112394755 13:99019488-99019510 TGTCATAAGAGGGAGCCACCTGG - Intronic
1116228852 14:42189254-42189276 TGTAACAAAATGGATCAACCTGG - Intergenic
1116722745 14:48521396-48521418 TGTGACAACATGGAGGAACCTGG + Intergenic
1122988118 14:105221953-105221975 TGTCACAAAAGCGGGCACCCTGG - Intronic
1124267296 15:28248183-28248205 TGTCACATGGGGGAGCCAGCTGG - Intronic
1124925242 15:34064103-34064125 TGTCACAGAAGGTAGAAACCAGG - Exonic
1126256204 15:46628126-46628148 TGTCACAGGAGGGACCAAGTGGG + Intergenic
1126909131 15:53399751-53399773 TGCCAAAGGAGGGAGCACCCCGG - Intergenic
1127681642 15:61303644-61303666 TTTCACAAGTGGGAAAAACCAGG - Intergenic
1128185264 15:65639338-65639360 CGTCTCCACAGGGAGCAACCTGG - Intronic
1128692607 15:69736545-69736567 TGTCACAATGGGGAGAAGCCAGG - Intergenic
1129191349 15:73939390-73939412 TGACACAAGAGGCAGCAGCTCGG - Intronic
1132956020 16:2594035-2594057 TGCCCCAAGAGGGAGGACCCAGG - Intronic
1133741893 16:8658201-8658223 TGCCACATGAAGGAGCACCCGGG + Intergenic
1134329247 16:13235412-13235434 TTTCACCACAGGGAGCACCCTGG + Exonic
1135740032 16:24967339-24967361 AGTTACAACAGGGAGCAACTGGG + Intronic
1136582201 16:31159843-31159865 TGCCACGAGAGGGAGCACCAAGG - Intergenic
1139550533 16:67670318-67670340 TGTCAAAGGAGGGAGCAGGCTGG - Intergenic
1143991837 17:10971013-10971035 TGTCACAAGAGGCAGCAGGGAGG + Intergenic
1147658440 17:42104355-42104377 TGGGACAACAGGGAGCACCCTGG + Intronic
1148239164 17:45988551-45988573 TTCCACAAGAGGAAGCAGCCAGG - Intronic
1148623719 17:49053526-49053548 TCCCACAACAGGGAGCTACCTGG - Exonic
1150798396 17:68259066-68259088 GCTCCCAAGAGGGAGCAACGCGG - Intergenic
1151354414 17:73550057-73550079 TGCAACCAGAGGGAGAAACCCGG - Intronic
1157067993 18:44374394-44374416 TTTCAGAAGAGGGAGCAACATGG + Intergenic
1157785142 18:50474712-50474734 TGTCACACTCAGGAGCAACCAGG + Intergenic
1159331867 18:67005271-67005293 TGTCACAACATGGATGAACCTGG - Intergenic
1160093934 18:75853012-75853034 TGTGACAACATGGAGGAACCTGG + Intergenic
1162902812 19:13805441-13805463 TGTCAATAGATGGAGCATCCTGG + Intronic
1163083683 19:14963148-14963170 TGTGACAAGAGGGTTGAACCTGG + Intronic
1165105058 19:33464349-33464371 TGTGACAAGCTGCAGCAACCAGG - Intronic
1165152146 19:33767136-33767158 TCTCCCAAGAGTGAGCCACCTGG + Intronic
1165340611 19:35209156-35209178 TTCCACAGGAGGGAGCAACGAGG + Intergenic
1165447889 19:35866668-35866690 TGCCCCAAGTGGGAGCAACATGG + Exonic
1165967076 19:39591025-39591047 TGTAACAAGAGTGAGAACCCTGG - Intergenic
1165978416 19:39697947-39697969 TGTAACAAGAGTGAGAACCCTGG - Intergenic
1166758817 19:45212086-45212108 TGTGCCAAGATGGAGCCACCAGG + Intronic
1168015480 19:53569587-53569609 TGCCAAAAAAGGGAGCAAACAGG - Intronic
925087827 2:1124631-1124653 TGTCACAACAGGGTTGAACCTGG + Intronic
925938446 2:8790688-8790710 TGCTAATAGAGGGAGCAACCTGG + Intronic
926319507 2:11739128-11739150 TGACCCAAGAGAGAGCAAGCAGG - Intronic
926661514 2:15472307-15472329 TGTCAACAGAGGGAGGAAGCGGG - Intronic
926715836 2:15922812-15922834 TGGCACAAGAGGGGGCTTCCAGG - Intergenic
928804745 2:35136941-35136963 TGTGACAACATGGAGGAACCTGG - Intergenic
929055577 2:37873492-37873514 GGTCAGGAGAGGGAGCAATCAGG + Intergenic
929135195 2:38617354-38617376 TATCATAAGAAGGAGGAACCTGG - Intergenic
929338180 2:40778137-40778159 TGTGACAAGATGGATGAACCTGG + Intergenic
929571270 2:43024586-43024608 TGGGAAAAGAGGGACCAACCAGG - Intergenic
930252021 2:49044856-49044878 TGTCACAAGAGGGAGTGCTCAGG + Intronic
930804343 2:55475239-55475261 TGTCTCCAGAGGCACCAACCTGG + Intergenic
933781296 2:85803381-85803403 TGTCAGAAGAGGGATCCACCAGG - Intergenic
934129214 2:88931380-88931402 TGACAGAAGAGAGAGCTACCTGG - Intergenic
938132856 2:128732241-128732263 TGTCAGAAGAGGGAGGTACCAGG - Intergenic
938159770 2:128974622-128974644 TGCTAGAGGAGGGAGCAACCTGG + Intergenic
946146463 2:217734910-217734932 TGTCACAAGAGGGACCCAGTAGG - Intronic
946312485 2:218890446-218890468 TGTGACATGTGGGAGCAACGTGG - Intronic
946464193 2:219896918-219896940 CCTCACTAGAGGGAGCAAACAGG + Intergenic
946660608 2:221995076-221995098 TGTAACAACATGGATCAACCTGG - Intergenic
947204039 2:227644074-227644096 TGTCACAATGGGGTGCATCCTGG + Intergenic
1169937574 20:10900942-10900964 TGTCACAACATGGATGAACCTGG + Intergenic
1169983100 20:11409500-11409522 TTTAACAAGAAGGAGAAACCTGG - Intergenic
1171084458 20:22224637-22224659 TGTCACATGAGGGAAAACCCAGG + Intergenic
1171145055 20:22774370-22774392 TGACACAAGAGGCAGCCCCCAGG - Intergenic
1173361566 20:42349301-42349323 TGCTATAACAGGGAGCAACCAGG - Intronic
1173772639 20:45676006-45676028 TGTCACAACATGGATGAACCTGG - Intergenic
1176365049 21:6027731-6027753 TGTGACTAGAGGGAGCCAACAGG - Intergenic
1178122019 21:29478666-29478688 TGGCACAAGAGAGAGGAACTTGG + Intronic
1178379729 21:32097728-32097750 TCTCACATGTGGGAGCAACTAGG - Intergenic
1179637856 21:42725032-42725054 TGTCACCACTGGGAGAAACCGGG - Intronic
1179758469 21:43510814-43510836 TGTGACTAGAGGGAGCCAACAGG + Intergenic
1179817744 21:43918312-43918334 TGTCTCTAGAGGTAGCCACCTGG + Intronic
1180026786 21:45169039-45169061 TCTCACAACAGGGAGCTATCCGG - Intronic
949329493 3:2906033-2906055 TGTGACAAAAGGGATGAACCTGG + Intronic
951800756 3:26593365-26593387 TGTGACAACAGGGATGAACCTGG - Intergenic
951946487 3:28142733-28142755 TGTCACAAGAGCCACCACCCAGG + Intergenic
954425208 3:50439566-50439588 TTTCACCACAGGGAGCAGCCAGG + Intronic
955744348 3:62125257-62125279 TTTCAAAAGAAGGATCAACCTGG + Intronic
960728049 3:120691818-120691840 TGGCACCAGAGAGAGCAAGCTGG - Intronic
960998471 3:123355050-123355072 AGTGACGAGAGGGAACAACCTGG - Intronic
961168398 3:124779315-124779337 TCTCAAAAGAGGGAGCAAAGGGG + Intronic
962988491 3:140557577-140557599 TGGCACAAGTGGGAGAAAACTGG + Intronic
964679699 3:159324026-159324048 TGTTACTAGAGATAGCAACCTGG + Intronic
966351683 3:179038196-179038218 TGTCCAAAGAGAGACCAACCTGG + Intronic
966552631 3:181222233-181222255 TGGCACAAGATGGACGAACCAGG + Intergenic
967633745 3:191777276-191777298 TGGCAGAAGAGGAAGCAAACAGG - Intergenic
973223972 4:47761562-47761584 TGCCACAACATGGATCAACCTGG + Intronic
975183471 4:71373893-71373915 TGCCTCAGGAGGTAGCAACCAGG + Intronic
976911040 4:90306018-90306040 TGTCACAACATGGATGAACCTGG + Intronic
977369722 4:96120363-96120385 TGTCCCAAGAGAGAGCAAAGGGG - Intergenic
977829237 4:101570918-101570940 TGTCACTAGAGATAGCAATCTGG - Intronic
979648303 4:123098662-123098684 TGTGACAATATGGATCAACCTGG - Intronic
981312163 4:143307843-143307865 TCTCACAAGAGGAAGCTTCCTGG + Intergenic
981809486 4:148757639-148757661 TGTCACAGGAGGGAGCATGGAGG + Intergenic
985814987 5:2120809-2120831 TGTAACAACATGGATCAACCTGG - Intergenic
988300013 5:29411134-29411156 TGAGACAAGAGGGATGAACCTGG + Intergenic
992864862 5:80947944-80947966 GGTCACAAGATGGAAGAACCAGG - Intergenic
992986293 5:82233988-82234010 AGTCACAAGAGGAAGCAAAAGGG + Intronic
993093574 5:83456943-83456965 TGTGATAAGATGGAGGAACCTGG + Intergenic
994024474 5:95066688-95066710 TGTGACAAGATGGACAAACCTGG + Intronic
995334653 5:110985085-110985107 TGTCACAAGAGTAGGCATCCTGG - Intergenic
997651972 5:135528935-135528957 TTTCACAAGAGGATGCCACCAGG + Intergenic
998523188 5:142818811-142818833 TGCCACAAGAAGGAGCAAACAGG - Intronic
999067965 5:148711928-148711950 TGCCATAAGAGGGAGAAACTGGG + Intergenic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
999321288 5:150616715-150616737 TGTCACCAGAGCTAGGAACCTGG + Intronic
1000054591 5:157593734-157593756 TGTGACAAGAGGGAGAGAGCGGG + Intergenic
1000433416 5:161179360-161179382 TGTCACAGTAGAAAGCAACCTGG + Intergenic
1000956639 5:167551818-167551840 TGTCCCAATAAGGAGCAATCTGG - Intronic
1004001672 6:11602072-11602094 TGTCCCTGCAGGGAGCAACCTGG + Intergenic
1004138347 6:12990479-12990501 CCTCACAAGAGGGAGCACACAGG + Intronic
1004268103 6:14167132-14167154 TGCCAGAGGAGGGAGTAACCAGG - Intergenic
1005167909 6:22946765-22946787 TGTCACAAGATGGAGGCACCTGG - Intergenic
1006239964 6:32668982-32669004 TGTCACCAGAAGGACCATCCAGG + Intergenic
1006451435 6:34107881-34107903 TGTCACAAGGAGGAGACACCTGG - Intronic
1008206613 6:48667714-48667736 TGTCAACAGTGGGAGAAACCAGG + Intergenic
1008705806 6:54157523-54157545 GGTCACAATAAGGAACAACCAGG - Intronic
1009187739 6:60594082-60594104 AGTGACAAGAGGCAGCAAACAGG + Intergenic
1009952685 6:70414205-70414227 GGTAACAAGAGTGAGAAACCTGG - Intronic
1010877907 6:81131177-81131199 TGTCAAAGGAGGGAGCAAGTGGG - Intergenic
1014254501 6:119147648-119147670 TGTCACCAGAGACAGCAGCCTGG - Intronic
1016444109 6:144115375-144115397 TGCCACAACATGGATCAACCTGG - Intergenic
1016568902 6:145491307-145491329 TGCCACAGGAGGGAGCATGCAGG + Intergenic
1017087347 6:150725960-150725982 TGTGACAAGATGGATGAACCTGG + Intronic
1017436461 6:154420128-154420150 TGTGACAAGAGGGATGAACCTGG + Intronic
1018702710 6:166439857-166439879 TGTCACTAGAGATAGCAATCTGG + Intronic
1018937846 6:168285220-168285242 TCTCATAAGAAGGAGCAATCTGG + Intergenic
1019205835 6:170360871-170360893 TTTCACAGGAGGGAGCCAGCAGG - Intronic
1021138700 7:16996595-16996617 TGTCACAGGAGGGACCAAGTGGG - Intergenic
1021138808 7:16997846-16997868 TGTCACAGGAGGGACCAAGTGGG - Intergenic
1022732048 7:33036316-33036338 TGTGACAAGAGTGAGAACCCTGG + Intronic
1023543843 7:41296419-41296441 TATCACAAGAAGAAGCTACCAGG + Intergenic
1025613030 7:63094969-63094991 TGGCACAGGAGGAAACAACCAGG - Intergenic
1028535354 7:91885777-91885799 TGTGGCAAGAGGGAACAAACAGG + Intergenic
1028579677 7:92395182-92395204 TATCACCAGAGGGTACAACCTGG - Intronic
1029379260 7:100202050-100202072 TGACTCAAGTGGGAGCAACAAGG + Exonic
1030114908 7:106055691-106055713 TGCCACAAGAGGGAGGAAGAAGG - Intergenic
1032188488 7:129748406-129748428 AGTCACAGGAGGGAGAAACCAGG + Intronic
1034894593 7:154868258-154868280 TGTCACCAGAGTGAGCATCTTGG - Intronic
1039203104 8:35118508-35118530 TGTTACTAGAGAGAGCAATCTGG + Intergenic
1040960977 8:53032505-53032527 TGTCACTAGAGAGAGCAGTCTGG + Intergenic
1042984834 8:74571892-74571914 TGGCACAAAAGGGAGAAACCAGG - Intergenic
1044240684 8:89885017-89885039 TTTCACTAGAGATAGCAACCTGG - Intergenic
1047301742 8:123619337-123619359 TGTCACTAGAGATAGAAACCTGG + Intergenic
1048546340 8:135390920-135390942 CATCACAAGAGGGCTCAACCAGG - Intergenic
1048611576 8:136028751-136028773 AGGAACAAGAGGGAGCAACAGGG + Intergenic
1049146790 8:141006382-141006404 TGGCACAAGAGGCAGTAACAGGG + Intergenic
1049862646 8:144910473-144910495 TGTCACCAGAGGGAGCACCCAGG + Intergenic
1050537049 9:6639855-6639877 TGTCACTAGAGATAGCAATCTGG - Intronic
1052470927 9:28895732-28895754 TGTCACAGGAGGGAGAACCGAGG + Intergenic
1053838881 9:42171621-42171643 TGTAACAAGATGGATAAACCTGG - Intergenic
1053879429 9:42577140-42577162 TGTAACAAGATGGACAAACCTGG + Intergenic
1053893229 9:42717197-42717219 TGTAACAAGATGGATAAACCTGG - Intergenic
1054232261 9:62524557-62524579 TGTAACAAGATGGACAAACCTGG - Intergenic
1054590413 9:67004564-67004586 TGTAACAAGATGGATAAACCTGG + Intergenic
1055616044 9:78074072-78074094 TGTCAAAAGAAGAAGAAACCGGG - Intergenic
1055805735 9:80090709-80090731 AATCAGAAGAGGGAGCCACCCGG - Intergenic
1056993993 9:91437803-91437825 TGTCACAACATGCAGAAACCTGG - Intergenic
1058907334 9:109492359-109492381 TATTCCAAGAGGGAGCATCCAGG - Intronic
1059581259 9:115550883-115550905 TGTGACATGAGGGAGAAACTAGG + Intergenic
1061505344 9:131028683-131028705 GGTCACAGAAGGGACCAACCAGG + Intronic
1062683430 9:137797374-137797396 TGTCACAAGAGCAAGACACCAGG - Intronic
1186219078 X:7330175-7330197 TGTTACAAAAGGCAGCAACAAGG + Intronic
1188466959 X:30492664-30492686 TGTACCAAGAGGGAGCAAGATGG - Intergenic
1189078956 X:37948736-37948758 TGTGACAATATGGAGGAACCTGG - Intronic
1190520804 X:51277772-51277794 TATCACAGAAGGGAGCACCCAGG + Intergenic
1190748307 X:53340005-53340027 TGTCACTAGAGGTGGCAAGCTGG - Intergenic
1191760080 X:64636992-64637014 TGTCACAATAGAAAGCAACATGG - Intergenic
1192605237 X:72509569-72509591 TGTGACAACAGGGACGAACCTGG + Intronic
1195396972 X:104421573-104421595 AGCCACAACAGGGATCAACCTGG - Intergenic
1201383543 Y:13413350-13413372 TGTCACATGGGGCAGCCACCCGG - Intronic