ID: 1066423123

View in Genome Browser
Species Human (GRCh38)
Location 10:35280055-35280077
Sequence ATAGATACAAAGATGAAACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 315}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066423123_1066423124 -2 Left 1066423123 10:35280055-35280077 CCACGTTTCATCTTTGTATCTAT 0: 1
1: 0
2: 2
3: 17
4: 315
Right 1066423124 10:35280076-35280098 ATGTCCAGTTGATTTTGACAAGG No data
1066423123_1066423127 15 Left 1066423123 10:35280055-35280077 CCACGTTTCATCTTTGTATCTAT 0: 1
1: 0
2: 2
3: 17
4: 315
Right 1066423127 10:35280093-35280115 ACAAGGGTACCAAGACCATTTGG No data
1066423123_1066423125 -1 Left 1066423123 10:35280055-35280077 CCACGTTTCATCTTTGTATCTAT 0: 1
1: 0
2: 2
3: 17
4: 315
Right 1066423125 10:35280077-35280099 TGTCCAGTTGATTTTGACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066423123 Original CRISPR ATAGATACAAAGATGAAACG TGG (reversed) Intronic
900515500 1:3080105-3080127 GAAGAAACAAAGAGGAAACGAGG + Intronic
900675494 1:3882874-3882896 ATGTATACGTAGATGAAACGTGG + Intronic
900997924 1:6132605-6132627 ACAGAGACAAAGATAAAACAGGG - Intronic
903590468 1:24451952-24451974 ACAAAGACAAAGAAGAAACGGGG + Intronic
904126544 1:28244250-28244272 AAGGAAACAAAGATGAAAGGGGG + Intronic
904393076 1:30198429-30198451 AGAGACACAGAGATGAAAAGGGG + Intergenic
905083385 1:35346157-35346179 ATAGATAAACAGATAAAATGTGG - Intronic
909058164 1:70846720-70846742 ATTAATATAAAGATGAAATGAGG - Intergenic
909927396 1:81454414-81454436 ATCAATACAAAGATGATACTTGG - Intronic
910662200 1:89685848-89685870 ATAGAGACAAAAAGGAAACAAGG + Intronic
912647091 1:111403475-111403497 CTAGAAACAATGATGAAACCGGG + Intergenic
913279466 1:117172175-117172197 ATAGAGAGAAAAAAGAAACGCGG + Intronic
913613919 1:120537333-120537355 GGAGATACAAATATGAAATGAGG + Intergenic
914373152 1:147049148-147049170 GGAGATACAAATATGAAATGAGG + Intergenic
914576349 1:148973561-148973583 GGAGATACAAATATGAAATGAGG - Intronic
914865598 1:151425537-151425559 ATAGAGACAAAGTTGAATTGTGG - Intronic
915411702 1:155705999-155706021 ATAGATAAATAAATGAAAAGAGG - Intronic
916672280 1:167033228-167033250 ATAGATTCAAGGAAGAAAAGTGG + Intergenic
917647288 1:177041605-177041627 ATAAAAACAAAGAAGAAAGGAGG - Intronic
917683143 1:177388317-177388339 AAAAATACAAAGATTAACCGGGG - Intergenic
918018524 1:180661994-180662016 ATAGAAACAAAGTTAAAAAGTGG - Intronic
918713086 1:187755923-187755945 ATAGATAGATAGATGAGAGGAGG - Intergenic
921346380 1:214189476-214189498 AAAGACACAAACATGAAACATGG - Intergenic
923192609 1:231634347-231634369 GTAAATACAGAGATAAAACGGGG + Intronic
923309470 1:232721885-232721907 TTATATACAAAGATGAAGCCAGG + Intergenic
923388670 1:233491510-233491532 ATAGCTACAAAAATAAAACACGG - Intergenic
923913401 1:238475362-238475384 CTAGATACAAAGATGGGAAGAGG + Intergenic
923917367 1:238524156-238524178 ACAGAGAGAAAGATGAAAAGAGG + Intergenic
1063900787 10:10730595-10730617 ATAGATGCAGAGATGAAAGAAGG + Intergenic
1065996566 10:31064748-31064770 ATAAACAAAAAGATTAAACGGGG - Intergenic
1066423123 10:35280055-35280077 ATAGATACAAAGATGAAACGTGG - Intronic
1066706104 10:38179679-38179701 ATAGAAACAAAGAGCAAACTGGG + Intergenic
1067809233 10:49414304-49414326 TTAGATACAAAGATGGAATGTGG - Intergenic
1075126108 10:119700642-119700664 AGAAATACAAAGAAGAAAAGGGG - Intergenic
1076999947 11:317914-317936 ATAGAAAAAAACCTGAAACGTGG + Intergenic
1077082877 11:732995-733017 ACAGATAAAAAGGGGAAACGTGG + Intergenic
1079614737 11:22478206-22478228 ATAGAAGCAAAGATGAGAAGAGG + Intergenic
1079794511 11:24783117-24783139 ATAGTTACAAAGATTAAAAGAGG - Intronic
1080023714 11:27591793-27591815 ATAAATACATAAATGAAATGTGG + Intergenic
1080091250 11:28351957-28351979 ATAGTTACAAAGGTGAAAACTGG + Intergenic
1080828101 11:35865209-35865231 AGAAATACAAATATGAAACTTGG - Intergenic
1080943712 11:36948002-36948024 ATAAATACATAGATGAGACTGGG + Intergenic
1080980936 11:37404651-37404673 GAAGATAGAAAGATGAAACAAGG - Intergenic
1082978454 11:59098441-59098463 AAAGACACAAAGATGAAGTGGGG + Intergenic
1084234185 11:67775775-67775797 ATAGATTCAAACATAAAATGAGG - Intergenic
1085064238 11:73477957-73477979 ATAGATAGATAGATAAAACAAGG + Intronic
1085106656 11:73849430-73849452 ATAGATAAAAAGTTGCCACGGGG - Intronic
1086027867 11:82316883-82316905 TTAGATACAAAGAAAAAATGTGG + Intergenic
1087976487 11:104555257-104555279 ATAGAAACACACATGAAACAAGG + Intergenic
1089348873 11:117810184-117810206 ATAGAGACAAAGGAGACACGTGG + Intronic
1089714186 11:120340716-120340738 ATAAATACAAAATTGAAATGGGG + Intronic
1089805669 11:121086377-121086399 ATAGATGGAAAGATGGAAGGAGG - Intronic
1091474633 12:760187-760209 ATACATGCAAAGATGAGACAAGG - Intronic
1091821410 12:3478253-3478275 ATAGATAGATAGATGATAGGTGG - Intronic
1091969665 12:4775716-4775738 ATAGATAGATAGATGAAACTGGG + Intronic
1092392347 12:8091999-8092021 ATAGATACAAAGATGACCTAAGG - Intronic
1094079327 12:26515758-26515780 ATGGATACAAATATGAACTGCGG - Intronic
1094229280 12:28084282-28084304 AGAGAGACGAAGATGAAATGAGG - Intergenic
1097326817 12:58286636-58286658 ATAAATGCAAAGATGTAACAGGG - Intergenic
1099060344 12:77900374-77900396 ATGGATACAAAGATGAGAACAGG - Intronic
1099526763 12:83726379-83726401 ATAGATATAAATATGTAAAGGGG - Intergenic
1100369588 12:93955494-93955516 ATGAATACAAAGATGAGAAGTGG + Intergenic
1101055431 12:100907527-100907549 GAAGATACAAAGATGAATTGAGG - Intronic
1101853977 12:108426943-108426965 AGAGAGTCAAAGATGAAAGGTGG - Intergenic
1102757371 12:115353858-115353880 ATAGATACACAGATAATAGGTGG + Intergenic
1105244535 13:18636874-18636896 ATATATAGAAAGCTGAAACTGGG + Intergenic
1106875975 13:34073323-34073345 TTAGATTCAAAGATGAAAATAGG - Intergenic
1108405305 13:50095060-50095082 CTAGTTACAAAGATGAATGGTGG - Intronic
1109199806 13:59417678-59417700 GCAGATACAAAGATGAACCTTGG - Intergenic
1109345297 13:61108790-61108812 ATAGATAGATAGATGAGAGGGGG - Intergenic
1109980134 13:69896622-69896644 ATAAATAGAAAGATGAAAAAGGG + Intronic
1110245590 13:73319994-73320016 ATAAAAACAAAGATGTAACAAGG + Intergenic
1112445911 13:99464116-99464138 ATAGATAGATAGATGAATGGTGG - Intergenic
1112687085 13:101842246-101842268 AGAGGCACAAAGATGAAATGAGG - Intronic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1113578149 13:111408952-111408974 ATAGAAACAAACATTAAACAAGG + Intergenic
1113821532 13:113217504-113217526 ATATTTACAAAGATCAAAAGAGG - Intronic
1115620800 14:35138162-35138184 GTACATACAAAGATGATACCAGG - Intronic
1116626203 14:47267140-47267162 ATAGATACAAAGGTGGAAAAGGG + Intronic
1118124366 14:62883820-62883842 ATAGATACAAAGAGGAAAGTTGG + Intronic
1120255346 14:82111881-82111903 ATAGATACAAAAATGGATCTAGG - Intergenic
1120789444 14:88565826-88565848 ATATATAAAAATATGAAACAAGG + Intronic
1121985230 14:98498790-98498812 AAAAATAGAAAGATGAAAGGAGG + Intergenic
1122262430 14:100531035-100531057 ATAGATGCAGAGATGAACCTGGG - Intergenic
1124213196 15:27780881-27780903 AGAGATACAAATATGAACCATGG - Intronic
1125147168 15:36485296-36485318 ATTGAGACAAGGATGAAAGGAGG - Intergenic
1125795421 15:42401032-42401054 AAAGATACAAAAATTAACCGGGG + Intronic
1126425656 15:48524569-48524591 AGAGTTGCAAAGAAGAAACGGGG + Intronic
1128741913 15:70089655-70089677 ATACCTACAAAAATGAGACGAGG + Intronic
1128900083 15:71412500-71412522 ATACATACGTAGATGAAAGGAGG - Intronic
1129804738 15:78446328-78446350 ATAAAAACAAAGTTGAAATGTGG - Intronic
1130089242 15:80805629-80805651 ATATATACAAACATAAAACTAGG + Intronic
1130433434 15:83872713-83872735 ATTAATACAATGATGAAACGAGG + Intronic
1132025611 15:98402236-98402258 ACAGATACAAAGATGAAAGTTGG - Intergenic
1132571318 16:645631-645653 ATAAGTAATAAGATGAAACGGGG + Intronic
1135634312 16:24060942-24060964 AAAGATACAAACATTAAACAAGG - Intronic
1138916352 16:61469418-61469440 AGAGATTCAAAGATGAGACCTGG + Intergenic
1139115002 16:63939974-63939996 AAAGATACAGAGATGAAATAAGG - Intergenic
1143424756 17:6826656-6826678 ATAGATAGATAGATAATACGAGG + Intronic
1144963362 17:19059642-19059664 ATAGAGAAAACTATGAAACGAGG + Intergenic
1144964328 17:19066398-19066420 ATAGAGAAAACTATGAAACGAGG - Intergenic
1144971797 17:19114883-19114905 ATAGAGAAAACTATGAAACGAGG - Intergenic
1144983638 17:19185746-19185768 ATAGAGAAAACTATGAAACGAGG + Intergenic
1144984587 17:19192493-19192515 ATAGAGAAAACTATGAAACGAGG - Intergenic
1145185658 17:20791709-20791731 ATAGATAGATAGATAAAAAGGGG + Intergenic
1147110650 17:38258546-38258568 AAAGAAACAAAGATGAAAATGGG - Intergenic
1148418861 17:47529876-47529898 AAAGAAACAAAGATGAAAATGGG + Intronic
1154444399 18:14423024-14423046 ATATATAGAAAGCTGAAACTGGG - Intergenic
1156024000 18:32631033-32631055 ATGGATTCAAAGATCAAATGTGG - Intergenic
1157014615 18:43696891-43696913 AGTGATACAAAGATGCAAAGGGG - Intergenic
1158655431 18:59326640-59326662 GTAGATACAATAATGAAACCTGG - Intergenic
1159559557 18:69978969-69978991 AGAGATACAAATATGGAATGGGG + Intergenic
1160052565 18:75449083-75449105 ATAGATACAATAAAGAAATGGGG + Intergenic
1160126490 18:76177423-76177445 ACAGATACAAAGTTTAAAAGGGG + Intergenic
1162281764 19:9703719-9703741 AAAGATACAGAGAGGAAAAGAGG + Intergenic
1164597919 19:29542236-29542258 ATAGATACAAGGATGATGAGTGG + Intronic
1167234724 19:48307210-48307232 AAAGAAAGAAAGATGAAATGAGG + Intronic
926433025 2:12809079-12809101 ACAGAGACAAAGAAGAAAAGTGG - Intergenic
926585628 2:14682568-14682590 ATAGATAGATAGATGAAAGGGGG + Intergenic
927379832 2:22466562-22466584 CTAGAAAAAGAGATGAAACGTGG + Intergenic
927598956 2:24423358-24423380 AGACAGACAAAGATGAAACAGGG + Intergenic
928160243 2:28916869-28916891 ATAGAAACAAACATAAAACAAGG - Intronic
930262061 2:49158352-49158374 ATACACACAAATATGAACCGAGG - Intergenic
931631407 2:64304403-64304425 ATAGATGCCAAGGTGAAAAGGGG - Intergenic
931995946 2:67839232-67839254 ATAGATACATAGATGATAGGTGG + Intergenic
932022654 2:68103396-68103418 CTAGAAACAAAGATGAAAGGAGG - Intronic
933041497 2:77473011-77473033 ATACATACAAAAATTAAACCTGG + Intronic
933486521 2:82931644-82931666 ATGCATACACAGATGAAAAGAGG - Intergenic
933663064 2:84943399-84943421 ATAGATACATGGGTGAAACAAGG + Intergenic
934021101 2:87953500-87953522 ATAAATGCACAGATGAAAAGAGG - Intergenic
934941950 2:98509144-98509166 AGGGATACAAAGATGATAAGAGG - Intronic
935150792 2:100433336-100433358 ATAGATAGATAGATAAAATGTGG + Intergenic
935464233 2:103376967-103376989 ATAGATACAAAGTGAAAACATGG - Intergenic
937269207 2:120637205-120637227 AGAAATACAAAGATAAAACATGG - Intergenic
937730906 2:125227744-125227766 ATAGAAACAAAAATGATACAGGG - Intergenic
938877123 2:135543829-135543851 ATAGATACAAAGATAAAAAGGGG + Intronic
939389485 2:141547824-141547846 GTGGATACAAAGATAAAAGGTGG + Intronic
941758419 2:169213852-169213874 TTAGATTGAAAGAGGAAACGTGG - Exonic
944279429 2:197878052-197878074 ATGGTAACAAAGATGAAAGGAGG + Intronic
945558677 2:211310983-211311005 CTAGATTAAAAGATGAAAAGTGG - Intergenic
945787924 2:214267195-214267217 ATAGATAAAAAGATAAAAGCTGG + Intronic
945793396 2:214332717-214332739 AAAGATAAAAAGATGGAGCGTGG - Intronic
948056810 2:235014731-235014753 ATTTATACAAAGAGGAAATGTGG - Intronic
1169734539 20:8823681-8823703 ATAGAAACAAAGATGCCACTAGG - Intronic
1169821746 20:9719007-9719029 ATAGAGACAAAGATCACAGGGGG - Intronic
1169993927 20:11535422-11535444 ATAAATAGAAAGATGCAAAGAGG + Intergenic
1170006206 20:11672088-11672110 CTAGATACAAAGAAGAATGGTGG - Intergenic
1170159264 20:13295851-13295873 ATAGATCCAAAGGTGCAACCTGG + Intronic
1170407991 20:16059679-16059701 TCAGATAAAAAGATGGAACGTGG - Intergenic
1170444325 20:16409701-16409723 CTAGACACAAAGAGGAGACGGGG + Intronic
1171815129 20:29779577-29779599 AGAGAAACAAAGATGAAAATAGG + Intergenic
1172788707 20:37487521-37487543 ATACAGACAAAGATGCAAAGAGG - Intergenic
1173477381 20:43370522-43370544 ATATATAGAAAGCTGAAACTGGG + Intergenic
1173804649 20:45916284-45916306 AATGATACAAAGATGAAGCCTGG - Intergenic
1176451582 21:6866841-6866863 ATATATAGAAAGCTGAAACTGGG + Intergenic
1176829750 21:13731892-13731914 ATATATAGAAAGCTGAAACTGGG + Intergenic
1177802578 21:25842389-25842411 ATAGATACAAAGATGACACATGG - Intergenic
1178180569 21:30156460-30156482 ATTGGTACAAAGATGAACTGAGG + Intergenic
1178225120 21:30707820-30707842 ATACATACAAGGAAGAAACAAGG + Intergenic
1178420188 21:32437184-32437206 ATAGATTCAAACATAAAATGAGG + Intronic
1181536887 22:23550959-23550981 AAAGATGGAAAGATGAAGCGTGG - Intergenic
1182588150 22:31358449-31358471 ATAAATAAAAAGAAGAATCGGGG + Intergenic
1184771174 22:46597464-46597486 ATAGATAGATAAATGAAACCAGG - Intronic
952004123 3:28822632-28822654 ATAGATAGACAGATGATAAGGGG + Intergenic
952190721 3:31020538-31020560 ATGGATACAAGGAGGAAATGGGG - Intergenic
953749802 3:45600541-45600563 AGAGACACAAAGAGGCAACGGGG - Intronic
955619633 3:60848694-60848716 ATTGTTATAAAGATGAAATGAGG + Intronic
955624746 3:60906305-60906327 GGAGATACAAATATGAAATGAGG + Intronic
956303340 3:67796657-67796679 GTACATACGAATATGAAACGGGG - Intergenic
956539847 3:70324140-70324162 ATAGATAGAGAGATGTAAAGGGG - Intergenic
957128624 3:76195647-76195669 GTAGATACACACATGAAATGTGG + Intronic
957881599 3:86221114-86221136 ATAGACACAAAGATGAGAACAGG + Intergenic
958636954 3:96757056-96757078 CTAGATACAAAGATGAGGAGAGG - Intergenic
958644050 3:96846085-96846107 ATAAACACAAAAATAAAACGAGG + Intronic
959240971 3:103793210-103793232 GTAGATAAATAGATGCAACGGGG - Intergenic
959301356 3:104606120-104606142 ATAGATAAAAAGTGGAAACATGG - Intergenic
959413894 3:106061013-106061035 AGTGATACAAAGATGAAACCAGG - Intergenic
959822240 3:110749751-110749773 AATGATACAAAGATGAATCATGG - Intergenic
960378439 3:116931253-116931275 AGAGATAGAGAGATGAAATGAGG + Intronic
961706681 3:128792382-128792404 ATAGATAAAAAGATGATAAAAGG - Intronic
962223605 3:133585653-133585675 AAAAATACAAAGATGTAGCGGGG - Intronic
962462795 3:135630156-135630178 TTAGATACAAAGATTAAAGAGGG + Intergenic
962642559 3:137402618-137402640 ATGGATATAAAGCTGAAATGAGG - Intergenic
962952161 3:140229220-140229242 AAAGCTAAAAAGAAGAAACGAGG + Intronic
963195948 3:142530259-142530281 ATAAAAACCAAGATGAAACGAGG - Intronic
963400787 3:144795913-144795935 ATAGATACAAAGATAATATGTGG - Intergenic
964723200 3:159788391-159788413 ATAGAAACAAAGCTGAAGAGTGG + Intronic
964993664 3:162846671-162846693 ATAGATTTAAAGAAGAAATGGGG - Intergenic
965147976 3:164930788-164930810 ATAGATAAAAGGTTGAAACAAGG + Intergenic
965374595 3:167907467-167907489 ATAGATAGATAGATAAAAGGGGG - Intergenic
965672822 3:171164472-171164494 ATAGTTGCAAAGATTAAACGAGG - Intronic
965691758 3:171364755-171364777 ATAGACACAGGGATGAAAAGTGG + Intronic
967056797 3:185836241-185836263 AGAGTTACAAATATGAAAAGTGG - Intergenic
968032721 3:195515396-195515418 ATAGATACATATATGAAAGAAGG - Exonic
969820959 4:9719981-9720003 ATAGACTCAAAGATAAAATGAGG + Intergenic
972885253 4:43477243-43477265 AATGATACAAAGTTGAAACTAGG + Intergenic
973834827 4:54798758-54798780 ATATATAGAAAGCTGAAACTGGG - Intergenic
974149563 4:57989480-57989502 CTAGAAACAAAGAAGAAACGTGG + Intergenic
975350884 4:73344698-73344720 ATAGAGACAAAGTAGAAATGTGG - Intergenic
975596815 4:76055106-76055128 GTAGATTCAAAGGTGAAACCAGG - Intronic
975780503 4:77834394-77834416 ATATATATAAAGAAGAAACTAGG + Intergenic
976264715 4:83179720-83179742 ATAGATAGATAGATAAAACTAGG - Intergenic
977070132 4:92374852-92374874 GTAGAAATAAGGATGAAACGTGG + Intronic
977940607 4:102854060-102854082 ATAAATCCAAATATGAAAAGAGG - Intronic
979155658 4:117386278-117386300 ATGGGTACAAAGATGAAAGTAGG + Intergenic
979310948 4:119202600-119202622 ATAGGTATAAAGCTGAAACTGGG + Intronic
979474269 4:121136292-121136314 ATAGATACAAAAATGAGAAGGGG - Intronic
980007960 4:127562653-127562675 ATAAATGCAAAGATGATAGGAGG + Intergenic
980701716 4:136441553-136441575 ACAGATTCAAAGATGAAATCAGG - Intergenic
981066896 4:140495235-140495257 ATAGATTCTCAAATGAAACGAGG - Intronic
982967651 4:161934047-161934069 ATTGTTACAAAGATCAAATGAGG - Intronic
983149212 4:164257252-164257274 ACAGATACATAGATGAACCTAGG - Intronic
983613161 4:169672246-169672268 ATAGATAGATAGATAAAATGAGG + Intronic
983630695 4:169846333-169846355 ATAAATACAAAGATGAATGAGGG - Intergenic
1202757906 4_GL000008v2_random:82430-82452 ATTGATGGATAGATGAAACGTGG + Intergenic
986118072 5:4800364-4800386 ATTGAGACAAAGATGAAGAGAGG + Intergenic
986207326 5:5637324-5637346 ATAGAGACAAGGAGGAAAGGCGG - Intergenic
988172700 5:27680330-27680352 ATATATAGAAAGCTGAAACTGGG + Intergenic
988374182 5:30412235-30412257 ATAGATACTAAGAAGAAATCAGG - Intergenic
988427915 5:31085328-31085350 AAAGTTACAAAGATGAAATTGGG + Intergenic
990858009 5:60293229-60293251 ATACTTAAAAAGATGTAACGCGG + Intronic
993143272 5:84061514-84061536 AAAGAAACAAAGATGACAAGAGG + Intronic
993419589 5:87684268-87684290 CAAAATTCAAAGATGAAACGTGG + Intergenic
995382902 5:111554636-111554658 ATAGAGACAAAGTAGAAAAGTGG - Intergenic
995987536 5:118197385-118197407 ATAGATGGAAAAATGACACGAGG - Intergenic
996060549 5:119028577-119028599 AGAGATACAAATATGGAATGAGG + Intergenic
996132166 5:119794852-119794874 ATATATAGAAAGCTGAAACTGGG - Intergenic
997279404 5:132629860-132629882 AGAGACACATAGATGAAAAGGGG + Intronic
998344811 5:141452570-141452592 AAAAATACAAAGATGGAAAGGGG - Intronic
998578846 5:143348807-143348829 ATAGAAACACACATGAAACAAGG + Intronic
998939474 5:147265525-147265547 AAAGTTACAAAAATGAAACAAGG + Intronic
999780851 5:154848977-154848999 AAAAAAACAAAGATGAAATGCGG + Intronic
1001188678 5:169604697-169604719 ATAAATACAAAGATGAACATTGG - Exonic
1001229356 5:169972616-169972638 ATAGATAGATAGATGATAGGTGG + Intronic
1002776152 6:329272-329294 AGAGATAGAAAGGTGAAAGGTGG + Intronic
1005704400 6:28437009-28437031 GTTGATACAAAGATAAAACGAGG + Intronic
1005797954 6:29387521-29387543 GTAGATACTAGGATGAAACTTGG - Intronic
1008255682 6:49297087-49297109 ATAGGTACAAAGATCCAAAGAGG - Intergenic
1010558116 6:77310316-77310338 ATAGATGAAAAGATGAGACCTGG - Intergenic
1011162342 6:84405204-84405226 TTAGTTACAAATATGAAACATGG + Intergenic
1011753671 6:90477961-90477983 AGAGACACAAAGAAGAAACAGGG + Intergenic
1013339230 6:109197041-109197063 AGAGATACAAAGATAGAACTTGG - Intergenic
1014209478 6:118692785-118692807 ATAGATACAATGATAGAAGGGGG + Intronic
1014746889 6:125210873-125210895 ACAGTTACAAAGTTGAAAAGGGG + Intronic
1015413768 6:132924885-132924907 AAAGATACAAAGATAAATAGTGG + Intergenic
1016062955 6:139649249-139649271 AAATATACAAAGAGGAAAGGAGG + Intergenic
1016522067 6:144956978-144957000 ATAGATACATAGATGATAGATGG - Intergenic
1016955688 6:149624678-149624700 ATAGAAATAAGGATGAAATGAGG - Intronic
1018091802 6:160351991-160352013 ATAAATACAAAGTTTCAACGAGG - Intronic
1019170847 6:170132421-170132443 CTAGGTACAAAGAGGAAAGGGGG + Intergenic
1019688445 7:2395822-2395844 ATAGATACATAGATGATAGATGG + Intergenic
1020317791 7:6918858-6918880 ATAGATTCAAACATAAAATGAGG - Intergenic
1020520676 7:9182461-9182483 GTAAATACAAAGATGAAAGTAGG - Intergenic
1020670394 7:11100195-11100217 ATAGACATAATAATGAAACGAGG + Intronic
1020733578 7:11916368-11916390 ATATATAGAAAAATAAAACGTGG + Intergenic
1022468615 7:30667892-30667914 AAGGATACAAAGATGACAAGAGG + Intronic
1022823506 7:33984930-33984952 AGAGATATAAAGATGGAAAGAGG - Intronic
1023469017 7:40492618-40492640 ATATATACAAAGATCTAACTTGG - Intronic
1023564912 7:41514629-41514651 AGAGTTAGAAAGATGAAAGGGGG - Intergenic
1024038636 7:45531556-45531578 ATAGAAACCAAGAGCAAACGAGG - Intergenic
1024100051 7:46022635-46022657 ATAGATCAAAAGATGAAGCAGGG - Intergenic
1024366523 7:48526968-48526990 ATATATACAAAAATGAAATTGGG - Intronic
1024873468 7:53993195-53993217 ATGGAGATAAAGATGAAATGGGG + Intergenic
1027401580 7:77814311-77814333 ATAGAAACACATATGAAACAAGG - Intronic
1028444472 7:90904563-90904585 AAAAATACAAAGATGAAAAATGG + Intronic
1028665677 7:93341268-93341290 ATAGTTACAAACATGAAAGCAGG + Intronic
1028669981 7:93390702-93390724 TTAGAAACAAAGAAGAAACTAGG + Intergenic
1028958867 7:96726171-96726193 ATAAATACAAATTTGAAATGTGG + Intergenic
1029509439 7:100984555-100984577 ACACATAAAAAGATGAAAAGTGG - Intronic
1029628492 7:101735298-101735320 ATAGAAAGAAAGAAGAAAGGAGG + Intergenic
1030437696 7:109545694-109545716 ATAAATACAAAGACTAAACTTGG + Intergenic
1032445385 7:131978110-131978132 ATAGATATAAAGATAAGACATGG - Intergenic
1032630418 7:133644966-133644988 ACACATACAAAGATGCAAAGGGG - Intronic
1032675989 7:134129821-134129843 ATAGATGCAAAGATGTAAAGAGG - Intronic
1033639393 7:143246720-143246742 AGAGAAACAAAGTTGAAATGTGG - Intronic
1033891898 7:146023652-146023674 ATAAAAACAAAAATGAAACATGG + Intergenic
1034785662 7:153923825-153923847 TGAGATACAAAGATGTAACCAGG - Intronic
1035318842 7:158015222-158015244 CTAGATTCAAAGATTCAACGTGG - Intronic
1036120354 8:6010790-6010812 ATAGAAACAAAGATAAAAACAGG + Intergenic
1036929231 8:12937322-12937344 ATAGATAAAAATATGGAAAGAGG + Intergenic
1037145550 8:15567680-15567702 ATAGATACTAGGGTGAAATGAGG + Intronic
1037221934 8:16534186-16534208 ATATTTACACAGATGAATCGGGG - Intronic
1037701606 8:21280354-21280376 ATATTTACAAACATGAAACTAGG - Intergenic
1037922474 8:22817098-22817120 AAAGACACAAAGATGAGAGGCGG + Intronic
1039168237 8:34711373-34711395 ATAGATACAAAAATGTTACATGG + Intergenic
1039953031 8:42187055-42187077 ATAGATACATAGATGATAGATGG - Intronic
1040844141 8:51818592-51818614 CTAGATACAAAAATGATATGGGG + Exonic
1042231338 8:66558111-66558133 AGAGATATAAAGAAGAAACCTGG - Intergenic
1042340426 8:67673071-67673093 AAATATACAAAGATGAACTGTGG + Intronic
1042573169 8:70189437-70189459 AGAGATACACAGATGAAAAATGG - Intronic
1042839982 8:73113865-73113887 ATGGATAGAAAAATGAAATGTGG - Intronic
1043557005 8:81442184-81442206 AAATATACAAATATGAAATGAGG - Exonic
1044718742 8:95125075-95125097 CTAGATACAAAGAAGAAAAAAGG + Intergenic
1044741387 8:95330509-95330531 ATAGAAACAAAGAAGAATGGTGG - Intergenic
1046026832 8:108734403-108734425 ATAGATAGACTGATGAAAGGGGG - Intronic
1046225205 8:111269493-111269515 ATAGATAGATAGATGAAAACTGG + Intergenic
1046366293 8:113236794-113236816 ATAGATAGATAGATGAGAGGCGG - Intronic
1046470787 8:114671085-114671107 ATAGCTACTAAGATGACATGAGG + Intergenic
1046501538 8:115084277-115084299 ATACATATACAAATGAAACGTGG - Intergenic
1047892752 8:129330898-129330920 ATAGATAGATAGATAAAAGGGGG + Intergenic
1048520305 8:135147823-135147845 ACAGACACAGAGAGGAAACGGGG - Intergenic
1048816763 8:138341372-138341394 AGAGATACAAAGTTGAATGGTGG + Intronic
1050243789 9:3666298-3666320 ACAGATATTAAGATGAAAAGAGG + Intergenic
1052412365 9:28138491-28138513 TTAGATTCAAATATGAAAAGTGG - Intronic
1052721406 9:32175274-32175296 ACAGATACAGAGATGGAAGGAGG - Intergenic
1055099300 9:72446706-72446728 ATAGATAAAAAGATAAAAGTTGG - Intergenic
1055126163 9:72720048-72720070 ATAGATACAAGCATGTAACATGG + Intronic
1056219173 9:84434470-84434492 AAAGAAACAAAGAGGAAATGTGG - Intergenic
1057019542 9:91685801-91685823 ATAGATAGACAGATGAGAGGGGG - Intronic
1057244941 9:93447203-93447225 ATAGAAAAAAAGAGGAAAAGGGG - Exonic
1058547037 9:106071760-106071782 ATACGTACAAAGATGAAAGAAGG + Intergenic
1059052892 9:110946872-110946894 ATAGATAAAAACTTGAAATGGGG + Intronic
1061599862 9:131661018-131661040 ATAGATAAAAAGAAAAAACAGGG + Intronic
1062523173 9:136968068-136968090 ATAGAAACAAAGATGTAATAGGG - Intergenic
1203517599 Un_GL000213v1:17676-17698 ATATATAGAAAGCTGAAACTGGG - Intergenic
1203366795 Un_KI270442v1:265901-265923 AGAGAAACAAAGATGAAAATAGG + Intergenic
1185481876 X:452338-452360 ATAGATAGATAGATGATAGGTGG - Intergenic
1185582419 X:1220923-1220945 ATAGATACATAGAAGAATGGAGG + Intergenic
1185659613 X:1716664-1716686 ATAGATACACAGATGATAGATGG - Intergenic
1185958693 X:4521730-4521752 ATAGATACATAGATGGATCATGG + Intergenic
1187535744 X:20140571-20140593 ACAGCTACAAAGAGGAAATGTGG + Intronic
1188672780 X:32900248-32900270 ATAAATACAAAAATGAAAATTGG + Intronic
1188933473 X:36144456-36144478 ATAGATAAAAATATAAAAAGAGG - Intronic
1190486010 X:50925932-50925954 ATAGATACAAAGTAGAATGGTGG - Intergenic
1191098764 X:56702372-56702394 ATAGAAACAAGGATCAAACATGG + Intergenic
1191216829 X:57941235-57941257 ATATGTACAAAGCTGAAACTGGG - Intergenic
1192460476 X:71312856-71312878 ATAAATACAAAGAAGATACATGG + Intergenic
1192471692 X:71404713-71404735 ATGGATACAAATATGAAATAAGG - Intronic
1193387531 X:80888805-80888827 ATAGGTAGAAAGCTGAAACTGGG - Intergenic
1197965599 X:132057376-132057398 CTAGGAACAAAGATGAAAGGTGG - Intergenic
1198638022 X:138721629-138721651 AAAGATACAGAGATGGAACTAGG - Intronic
1199002122 X:142651277-142651299 ATAGATAGAGACATGAAATGAGG + Intergenic
1199045182 X:143161827-143161849 ATAGATAAAGAGAGGAAAAGAGG - Intergenic
1199123424 X:144085629-144085651 ATAAATGCACAGATGAAAAGAGG + Intergenic
1199830436 X:151544423-151544445 TTAAATACAAAGATGAAGAGAGG - Intergenic