ID: 1066425580

View in Genome Browser
Species Human (GRCh38)
Location 10:35304769-35304791
Sequence TTGCAACTAGGGGATGCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066425580_1066425586 -1 Left 1066425580 10:35304769-35304791 CCAGTGGCATCCCCTAGTTGCAA No data
Right 1066425586 10:35304791-35304813 ACAACCAAAAATGTCTCCTGGGG No data
1066425580_1066425587 0 Left 1066425580 10:35304769-35304791 CCAGTGGCATCCCCTAGTTGCAA No data
Right 1066425587 10:35304792-35304814 CAACCAAAAATGTCTCCTGGGGG No data
1066425580_1066425585 -2 Left 1066425580 10:35304769-35304791 CCAGTGGCATCCCCTAGTTGCAA No data
Right 1066425585 10:35304790-35304812 AACAACCAAAAATGTCTCCTGGG No data
1066425580_1066425592 30 Left 1066425580 10:35304769-35304791 CCAGTGGCATCCCCTAGTTGCAA No data
Right 1066425592 10:35304822-35304844 GCCCAGGTTGAGAACCACTAGGG No data
1066425580_1066425584 -3 Left 1066425580 10:35304769-35304791 CCAGTGGCATCCCCTAGTTGCAA No data
Right 1066425584 10:35304789-35304811 CAACAACCAAAAATGTCTCCTGG No data
1066425580_1066425589 14 Left 1066425580 10:35304769-35304791 CCAGTGGCATCCCCTAGTTGCAA No data
Right 1066425589 10:35304806-35304828 TCCTGGGGGCATAATTGCCCAGG No data
1066425580_1066425591 29 Left 1066425580 10:35304769-35304791 CCAGTGGCATCCCCTAGTTGCAA No data
Right 1066425591 10:35304821-35304843 TGCCCAGGTTGAGAACCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066425580 Original CRISPR TTGCAACTAGGGGATGCCAC TGG (reversed) Intronic