ID: 1066425581

View in Genome Browser
Species Human (GRCh38)
Location 10:35304779-35304801
Sequence TTTTTGGTTGTTGCAACTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066425581_1066425589 4 Left 1066425581 10:35304779-35304801 CCCCTAGTTGCAACAACCAAAAA No data
Right 1066425589 10:35304806-35304828 TCCTGGGGGCATAATTGCCCAGG No data
1066425581_1066425591 19 Left 1066425581 10:35304779-35304801 CCCCTAGTTGCAACAACCAAAAA No data
Right 1066425591 10:35304821-35304843 TGCCCAGGTTGAGAACCACTAGG No data
1066425581_1066425598 30 Left 1066425581 10:35304779-35304801 CCCCTAGTTGCAACAACCAAAAA No data
Right 1066425598 10:35304832-35304854 AGAACCACTAGGGTGTTAGGGGG No data
1066425581_1066425597 29 Left 1066425581 10:35304779-35304801 CCCCTAGTTGCAACAACCAAAAA No data
Right 1066425597 10:35304831-35304853 GAGAACCACTAGGGTGTTAGGGG No data
1066425581_1066425587 -10 Left 1066425581 10:35304779-35304801 CCCCTAGTTGCAACAACCAAAAA No data
Right 1066425587 10:35304792-35304814 CAACCAAAAATGTCTCCTGGGGG No data
1066425581_1066425595 27 Left 1066425581 10:35304779-35304801 CCCCTAGTTGCAACAACCAAAAA No data
Right 1066425595 10:35304829-35304851 TTGAGAACCACTAGGGTGTTAGG No data
1066425581_1066425596 28 Left 1066425581 10:35304779-35304801 CCCCTAGTTGCAACAACCAAAAA No data
Right 1066425596 10:35304830-35304852 TGAGAACCACTAGGGTGTTAGGG No data
1066425581_1066425592 20 Left 1066425581 10:35304779-35304801 CCCCTAGTTGCAACAACCAAAAA No data
Right 1066425592 10:35304822-35304844 GCCCAGGTTGAGAACCACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066425581 Original CRISPR TTTTTGGTTGTTGCAACTAG GGG (reversed) Intronic