ID: 1066425582

View in Genome Browser
Species Human (GRCh38)
Location 10:35304780-35304802
Sequence ATTTTTGGTTGTTGCAACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066425582_1066425589 3 Left 1066425582 10:35304780-35304802 CCCTAGTTGCAACAACCAAAAAT No data
Right 1066425589 10:35304806-35304828 TCCTGGGGGCATAATTGCCCAGG No data
1066425582_1066425592 19 Left 1066425582 10:35304780-35304802 CCCTAGTTGCAACAACCAAAAAT No data
Right 1066425592 10:35304822-35304844 GCCCAGGTTGAGAACCACTAGGG No data
1066425582_1066425598 29 Left 1066425582 10:35304780-35304802 CCCTAGTTGCAACAACCAAAAAT No data
Right 1066425598 10:35304832-35304854 AGAACCACTAGGGTGTTAGGGGG No data
1066425582_1066425591 18 Left 1066425582 10:35304780-35304802 CCCTAGTTGCAACAACCAAAAAT No data
Right 1066425591 10:35304821-35304843 TGCCCAGGTTGAGAACCACTAGG No data
1066425582_1066425596 27 Left 1066425582 10:35304780-35304802 CCCTAGTTGCAACAACCAAAAAT No data
Right 1066425596 10:35304830-35304852 TGAGAACCACTAGGGTGTTAGGG No data
1066425582_1066425595 26 Left 1066425582 10:35304780-35304802 CCCTAGTTGCAACAACCAAAAAT No data
Right 1066425595 10:35304829-35304851 TTGAGAACCACTAGGGTGTTAGG No data
1066425582_1066425597 28 Left 1066425582 10:35304780-35304802 CCCTAGTTGCAACAACCAAAAAT No data
Right 1066425597 10:35304831-35304853 GAGAACCACTAGGGTGTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066425582 Original CRISPR ATTTTTGGTTGTTGCAACTA GGG (reversed) Intronic