ID: 1066425588

View in Genome Browser
Species Human (GRCh38)
Location 10:35304795-35304817
Sequence ATGCCCCCAGGAGACATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066425588_1066425591 3 Left 1066425588 10:35304795-35304817 CCAAAAATGTCTCCTGGGGGCAT No data
Right 1066425591 10:35304821-35304843 TGCCCAGGTTGAGAACCACTAGG No data
1066425588_1066425596 12 Left 1066425588 10:35304795-35304817 CCAAAAATGTCTCCTGGGGGCAT No data
Right 1066425596 10:35304830-35304852 TGAGAACCACTAGGGTGTTAGGG No data
1066425588_1066425595 11 Left 1066425588 10:35304795-35304817 CCAAAAATGTCTCCTGGGGGCAT No data
Right 1066425595 10:35304829-35304851 TTGAGAACCACTAGGGTGTTAGG No data
1066425588_1066425598 14 Left 1066425588 10:35304795-35304817 CCAAAAATGTCTCCTGGGGGCAT No data
Right 1066425598 10:35304832-35304854 AGAACCACTAGGGTGTTAGGGGG No data
1066425588_1066425592 4 Left 1066425588 10:35304795-35304817 CCAAAAATGTCTCCTGGGGGCAT No data
Right 1066425592 10:35304822-35304844 GCCCAGGTTGAGAACCACTAGGG No data
1066425588_1066425597 13 Left 1066425588 10:35304795-35304817 CCAAAAATGTCTCCTGGGGGCAT No data
Right 1066425597 10:35304831-35304853 GAGAACCACTAGGGTGTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066425588 Original CRISPR ATGCCCCCAGGAGACATTTT TGG (reversed) Intronic