ID: 1066425592

View in Genome Browser
Species Human (GRCh38)
Location 10:35304822-35304844
Sequence GCCCAGGTTGAGAACCACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066425588_1066425592 4 Left 1066425588 10:35304795-35304817 CCAAAAATGTCTCCTGGGGGCAT No data
Right 1066425592 10:35304822-35304844 GCCCAGGTTGAGAACCACTAGGG No data
1066425582_1066425592 19 Left 1066425582 10:35304780-35304802 CCCTAGTTGCAACAACCAAAAAT No data
Right 1066425592 10:35304822-35304844 GCCCAGGTTGAGAACCACTAGGG No data
1066425583_1066425592 18 Left 1066425583 10:35304781-35304803 CCTAGTTGCAACAACCAAAAATG No data
Right 1066425592 10:35304822-35304844 GCCCAGGTTGAGAACCACTAGGG No data
1066425580_1066425592 30 Left 1066425580 10:35304769-35304791 CCAGTGGCATCCCCTAGTTGCAA No data
Right 1066425592 10:35304822-35304844 GCCCAGGTTGAGAACCACTAGGG No data
1066425590_1066425592 -8 Left 1066425590 10:35304807-35304829 CCTGGGGGCATAATTGCCCAGGT No data
Right 1066425592 10:35304822-35304844 GCCCAGGTTGAGAACCACTAGGG No data
1066425581_1066425592 20 Left 1066425581 10:35304779-35304801 CCCCTAGTTGCAACAACCAAAAA No data
Right 1066425592 10:35304822-35304844 GCCCAGGTTGAGAACCACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066425592 Original CRISPR GCCCAGGTTGAGAACCACTA GGG Intronic