ID: 1066425592

View in Genome Browser
Species Human (GRCh38)
Location 10:35304822-35304844
Sequence GCCCAGGTTGAGAACCACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066425583_1066425592 18 Left 1066425583 10:35304781-35304803 CCTAGTTGCAACAACCAAAAATG 0: 8
1: 39
2: 223
3: 645
4: 1119
Right 1066425592 10:35304822-35304844 GCCCAGGTTGAGAACCACTAGGG No data
1066425590_1066425592 -8 Left 1066425590 10:35304807-35304829 CCTGGGGGCATAATTGCCCAGGT 0: 1
1: 0
2: 3
3: 11
4: 99
Right 1066425592 10:35304822-35304844 GCCCAGGTTGAGAACCACTAGGG No data
1066425582_1066425592 19 Left 1066425582 10:35304780-35304802 CCCTAGTTGCAACAACCAAAAAT 0: 2
1: 10
2: 79
3: 302
4: 868
Right 1066425592 10:35304822-35304844 GCCCAGGTTGAGAACCACTAGGG No data
1066425580_1066425592 30 Left 1066425580 10:35304769-35304791 CCAGTGGCATCCCCTAGTTGCAA 0: 1
1: 0
2: 1
3: 9
4: 70
Right 1066425592 10:35304822-35304844 GCCCAGGTTGAGAACCACTAGGG No data
1066425581_1066425592 20 Left 1066425581 10:35304779-35304801 CCCCTAGTTGCAACAACCAAAAA 0: 2
1: 8
2: 65
3: 219
4: 729
Right 1066425592 10:35304822-35304844 GCCCAGGTTGAGAACCACTAGGG No data
1066425588_1066425592 4 Left 1066425588 10:35304795-35304817 CCAAAAATGTCTCCTGGGGGCAT 0: 1
1: 0
2: 0
3: 23
4: 173
Right 1066425592 10:35304822-35304844 GCCCAGGTTGAGAACCACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066425592 Original CRISPR GCCCAGGTTGAGAACCACTA GGG Intronic
No off target data available for this crispr