ID: 1066429449

View in Genome Browser
Species Human (GRCh38)
Location 10:35337249-35337271
Sequence ACAGTCGCACAGCCAACGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 40}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066429438_1066429449 -1 Left 1066429438 10:35337227-35337249 CCCCCTACCCGCCCCCGCGGCAA 0: 1
1: 0
2: 1
3: 20
4: 197
Right 1066429449 10:35337249-35337271 ACAGTCGCACAGCCAACGTCGGG 0: 1
1: 0
2: 0
3: 5
4: 40
1066429434_1066429449 8 Left 1066429434 10:35337218-35337240 CCCGCCGAGCCCCCTACCCGCCC 0: 1
1: 0
2: 1
3: 38
4: 562
Right 1066429449 10:35337249-35337271 ACAGTCGCACAGCCAACGTCGGG 0: 1
1: 0
2: 0
3: 5
4: 40
1066429443_1066429449 -9 Left 1066429443 10:35337235-35337257 CCGCCCCCGCGGCAACAGTCGCA 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1066429449 10:35337249-35337271 ACAGTCGCACAGCCAACGTCGGG 0: 1
1: 0
2: 0
3: 5
4: 40
1066429442_1066429449 -8 Left 1066429442 10:35337234-35337256 CCCGCCCCCGCGGCAACAGTCGC 0: 1
1: 0
2: 0
3: 14
4: 81
Right 1066429449 10:35337249-35337271 ACAGTCGCACAGCCAACGTCGGG 0: 1
1: 0
2: 0
3: 5
4: 40
1066429435_1066429449 7 Left 1066429435 10:35337219-35337241 CCGCCGAGCCCCCTACCCGCCCC 0: 1
1: 0
2: 5
3: 88
4: 900
Right 1066429449 10:35337249-35337271 ACAGTCGCACAGCCAACGTCGGG 0: 1
1: 0
2: 0
3: 5
4: 40
1066429436_1066429449 4 Left 1066429436 10:35337222-35337244 CCGAGCCCCCTACCCGCCCCCGC 0: 1
1: 0
2: 12
3: 125
4: 1114
Right 1066429449 10:35337249-35337271 ACAGTCGCACAGCCAACGTCGGG 0: 1
1: 0
2: 0
3: 5
4: 40
1066429441_1066429449 -4 Left 1066429441 10:35337230-35337252 CCTACCCGCCCCCGCGGCAACAG 0: 1
1: 0
2: 0
3: 10
4: 149
Right 1066429449 10:35337249-35337271 ACAGTCGCACAGCCAACGTCGGG 0: 1
1: 0
2: 0
3: 5
4: 40
1066429439_1066429449 -2 Left 1066429439 10:35337228-35337250 CCCCTACCCGCCCCCGCGGCAAC 0: 1
1: 0
2: 0
3: 19
4: 167
Right 1066429449 10:35337249-35337271 ACAGTCGCACAGCCAACGTCGGG 0: 1
1: 0
2: 0
3: 5
4: 40
1066429440_1066429449 -3 Left 1066429440 10:35337229-35337251 CCCTACCCGCCCCCGCGGCAACA 0: 1
1: 0
2: 0
3: 2
4: 79
Right 1066429449 10:35337249-35337271 ACAGTCGCACAGCCAACGTCGGG 0: 1
1: 0
2: 0
3: 5
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066429449 Original CRISPR ACAGTCGCACAGCCAACGTC GGG Intronic
901869174 1:12127383-12127405 GCAGTGGCACAGCCAGCCTCAGG + Intronic
906785567 1:48612518-48612540 ACAGTCTTACAGCCAAGGCCTGG + Intronic
917122253 1:171654988-171655010 ACGGTCGCACAGCCAACCAATGG + Intergenic
920676265 1:208040561-208040583 AAGGTCACACAGCCAACGTATGG - Intronic
923034963 1:230279364-230279386 ACAGTCGCACGGCCAAGAGCGGG + Exonic
1062959633 10:1562769-1562791 TCAGTAGGACAGCCAAGGTCAGG + Intronic
1063237473 10:4132908-4132930 ACAGCAGCACAGCCAAGGTCAGG - Intergenic
1066429449 10:35337249-35337271 ACAGTCGCACAGCCAACGTCGGG + Intronic
1070355100 10:75632042-75632064 CCAGAAGCACAGCCAACGTCTGG - Intronic
1074872128 10:117585496-117585518 CAAGTCACACAGCCAAGGTCAGG - Intergenic
1081619751 11:44612281-44612303 AAAGTCACACAGCCAACATGCGG - Intronic
1083855981 11:65393341-65393363 ACAGTCACACAGCAAGCGACGGG - Intronic
1084722535 11:70916541-70916563 ACAGTAGCACAGCAAGCTTCAGG + Intronic
1099365797 12:81764344-81764366 CCAGTCACAGAGCCAACGTGAGG - Intergenic
1112493725 13:99889167-99889189 ACAGACTCACAGCCACCGTTTGG + Intronic
1113197699 13:107828021-107828043 ACATTGGCACAGCCAGCTTCAGG - Intronic
1119971196 14:78972554-78972576 ACATCCACACAGCCAACCTCAGG - Intronic
1122487825 14:102093591-102093613 ACAGTCACACAGCCAGCGAGTGG - Intronic
1132685436 16:1160093-1160115 ACGGTCGCACAGTCAAGGTCAGG + Intronic
1135178223 16:20250508-20250530 ACAGGCGCACAGGCCACGCCCGG + Intergenic
1137459760 16:48649703-48649725 ACAGTCCCACAGGCCACCTCTGG - Intergenic
1137744321 16:50809775-50809797 ACAGTCCCACAGCACAGGTCTGG - Intergenic
1141347233 16:83258210-83258232 ACAGAGGCATAGCCAAAGTCTGG + Intronic
1151892558 17:76959198-76959220 ACACTCACGCAGCCACCGTCTGG + Intergenic
1155046672 18:22109186-22109208 ACAGACCCAGAGCCAATGTCTGG - Intergenic
1156447085 18:37245058-37245080 ACAGTCACACAGACAGTGTCTGG + Exonic
1163033038 19:14556744-14556766 ACAGTCCCAAAGCCGATGTCAGG - Intronic
1163641842 19:18466527-18466549 GCAGGGGCACAGCCAAAGTCAGG - Intronic
926434351 2:12823436-12823458 ACAGCAACACAGCCAATGTCAGG - Intergenic
946174346 2:217913356-217913378 ACAGTTGCACAGCCTCAGTCAGG - Intronic
950697814 3:14717106-14717128 AAAGTTGCACAGCCAAAGTCTGG - Intronic
951730231 3:25802416-25802438 CCAGTCACACAGCCAAAGACTGG + Intergenic
957741009 3:84268216-84268238 ACATTCCCACTGCCAACATCGGG - Intergenic
975947529 4:79725470-79725492 ACTGTCACACAGCCAATGTATGG - Intergenic
988388815 5:30600791-30600813 ACAGTCACACAGCCAGAGTGGGG - Intergenic
1000284388 5:159814737-159814759 CCAGTAGCACAGCCACCTTCTGG - Intergenic
1006954142 6:37852103-37852125 ACAGTCGCACAGCCTAGTTTGGG - Intronic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1026912830 7:74101567-74101589 GCATTCGCCCAGCCAACATCTGG + Intronic
1027231123 7:76273168-76273190 ACAGACGAACAGACAAAGTCAGG - Intronic
1036417804 8:8566543-8566565 ACAGTCGCAGAACCCACGACTGG - Intergenic
1052167790 9:25354881-25354903 ACTGTCTCACATCCAAGGTCAGG - Intergenic
1060330635 9:122666070-122666092 ACAGCCACAGAGCCAAGGTCTGG - Intergenic
1061264917 9:129499264-129499286 CCAGTGGCTCAGCCAAGGTCAGG + Intergenic
1061542043 9:131282823-131282845 ACAGTCTCCCAGCCCAGGTCCGG + Intergenic
1193563860 X:83053703-83053725 ACAGTTGTACACCCAACGCCTGG + Intergenic