ID: 1066430562

View in Genome Browser
Species Human (GRCh38)
Location 10:35347154-35347176
Sequence CAGACACATTGTCCCGTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066430556_1066430562 5 Left 1066430556 10:35347126-35347148 CCCTTATTGGGGATGTGTAGTGG No data
Right 1066430562 10:35347154-35347176 CAGACACATTGTCCCGTACTGGG No data
1066430558_1066430562 4 Left 1066430558 10:35347127-35347149 CCTTATTGGGGATGTGTAGTGGG No data
Right 1066430562 10:35347154-35347176 CAGACACATTGTCCCGTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066430562 Original CRISPR CAGACACATTGTCCCGTACT GGG Intronic