ID: 1066434172

View in Genome Browser
Species Human (GRCh38)
Location 10:35381436-35381458
Sequence CTGTAATCCCAGCTACTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066434163_1066434172 28 Left 1066434163 10:35381385-35381407 CCCCGTCTCTACTAAAAATACAA 0: 98173
1: 216399
2: 153384
3: 81062
4: 60801
Right 1066434172 10:35381436-35381458 CTGTAATCCCAGCTACTGGAGGG No data
1066434165_1066434172 26 Left 1066434165 10:35381387-35381409 CCGTCTCTACTAAAAATACAAAA 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
Right 1066434172 10:35381436-35381458 CTGTAATCCCAGCTACTGGAGGG No data
1066434164_1066434172 27 Left 1066434164 10:35381386-35381408 CCCGTCTCTACTAAAAATACAAA 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843
Right 1066434172 10:35381436-35381458 CTGTAATCCCAGCTACTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066434172 Original CRISPR CTGTAATCCCAGCTACTGGA GGG Intronic
No off target data available for this crispr