ID: 1066434172 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:35381436-35381458 |
| Sequence | CTGTAATCCCAGCTACTGGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1066434163_1066434172 | 28 | Left | 1066434163 | 10:35381385-35381407 | CCCCGTCTCTACTAAAAATACAA | 0: 98173 1: 216399 2: 153384 3: 81062 4: 60801 |
||
| Right | 1066434172 | 10:35381436-35381458 | CTGTAATCCCAGCTACTGGAGGG | No data | ||||
| 1066434165_1066434172 | 26 | Left | 1066434165 | 10:35381387-35381409 | CCGTCTCTACTAAAAATACAAAA | 0: 194929 1: 143151 2: 66814 3: 37831 4: 46551 |
||
| Right | 1066434172 | 10:35381436-35381458 | CTGTAATCCCAGCTACTGGAGGG | No data | ||||
| 1066434164_1066434172 | 27 | Left | 1066434164 | 10:35381386-35381408 | CCCGTCTCTACTAAAAATACAAA | 0: 164005 1: 210050 2: 126715 3: 67031 4: 60843 |
||
| Right | 1066434172 | 10:35381436-35381458 | CTGTAATCCCAGCTACTGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1066434172 | Original CRISPR | CTGTAATCCCAGCTACTGGA GGG | Intronic | ||
| No off target data available for this crispr | |||||