ID: 1066435800

View in Genome Browser
Species Human (GRCh38)
Location 10:35395964-35395986
Sequence AGACCCAAAGCCTCTCTCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066435800_1066435805 14 Left 1066435800 10:35395964-35395986 CCCCCGAGAGAGGCTTTGGGTCT 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1066435805 10:35396001-35396023 GTTACTGTGTTATGCTGTGGTGG No data
1066435800_1066435804 11 Left 1066435800 10:35395964-35395986 CCCCCGAGAGAGGCTTTGGGTCT 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1066435804 10:35395998-35396020 CATGTTACTGTGTTATGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066435800 Original CRISPR AGACCCAAAGCCTCTCTCGG GGG (reversed) Intronic
909852563 1:80486839-80486861 AGACACAAAGCCCCTCTGTGAGG - Intergenic
914403931 1:147350822-147350844 AGAACAAAAGCTTCTCTCAGTGG - Intergenic
916675686 1:167062909-167062931 AGACCCCAAGTCTAACTCGGGGG - Intronic
924848429 1:247797707-247797729 AGTCCCAAAGCATCTGTAGGAGG - Intergenic
1066421140 10:35265898-35265920 TGACCCACAGCCTCTCCCGGTGG - Intronic
1066435800 10:35395964-35395986 AGACCCAAAGCCTCTCTCGGGGG - Intronic
1072878882 10:99203993-99204015 AGACTCCAAGCCTGTCTCAGTGG + Intronic
1074875426 10:117609812-117609834 AGACCCACAGCCACTCCCTGAGG + Intergenic
1082783627 11:57304521-57304543 AGGCCCAAAGCCTCTCCCTGGGG + Intronic
1085018302 11:73189572-73189594 AGACCCATAGCTTCCCTCCGTGG - Intergenic
1090276495 11:125423689-125423711 AGACCCAAAGCCCCTGTAGTAGG + Intronic
1099436056 12:82646323-82646345 AGGCCTAAAGCCTCTCTCATAGG - Intergenic
1100982318 12:100171413-100171435 AGACCCAAATCCTCTTTCCTTGG - Intergenic
1105018580 12:132801510-132801532 AGTTCCAAAGCCTCTCTTGCTGG - Intronic
1112005468 13:95249945-95249967 AGACCCAAAGCTTCTATTAGAGG + Intronic
1119475149 14:74922847-74922869 AGACCCACAGCCTCAGCCGGCGG + Intronic
1121421316 14:93817604-93817626 AGACGAAAACCCTCTCTCGTGGG + Intergenic
1121988631 14:98532522-98532544 ACACCAAAACCCTCTCTGGGAGG - Intergenic
1123472548 15:20565929-20565951 AGACCCAAATCCTCTGTCCTTGG + Intergenic
1123645455 15:22434424-22434446 AGACCCAAATCCTCTGTCCTTGG - Intergenic
1123666704 15:22613992-22614014 AGACCCAAATCCTCTGTCCTTGG - Intergenic
1123732853 15:23160920-23160942 AGACCCAAATCCTCTGTCCTTGG + Intergenic
1123750986 15:23358297-23358319 AGACCCAAATCCTCTGTCCTTGG + Intronic
1124203603 15:27698878-27698900 AGACCCAAGCCCTCTCTCCTTGG - Intergenic
1124283358 15:28382215-28382237 AGACCCAAATCCTCTGTCCTTGG + Intronic
1124299340 15:28529398-28529420 AGACCCAAATCCTCTGTCCTTGG - Intronic
1124320546 15:28708565-28708587 AGACCCAAATCCTCTGTCCTTGG - Intronic
1124481948 15:30086784-30086806 AGACCCAAATCCTCTGTCCTTGG + Intronic
1124488404 15:30138882-30138904 AGACCCAAATCCTCTGTCCTTGG + Intronic
1124521642 15:30410419-30410441 AGACCCAAATCCTCTGTCCTTGG - Intronic
1124537019 15:30555800-30555822 AGACCCAAATCCTCTGTCCTTGG + Intronic
1124543493 15:30607856-30607878 AGACCCAAATCCTCTGTCCTTGG + Intronic
1124563451 15:30795307-30795329 AGACCCAAATCCTCTGTCCTTGG + Intergenic
1124755123 15:32399438-32399460 AGACCCAAATCCTCTGTCCTTGG - Intronic
1124761629 15:32451791-32451813 AGACCCAAATCCTCTGTCCTTGG - Intronic
1124777000 15:32597277-32597299 AGACCCAAATCCTCTGTCCTTGG + Intronic
1124959832 15:34385922-34385944 AGACCCAAATCCTCTGTCCTTGG - Intronic
1124976459 15:34532143-34532165 AGACCCAAATCCTCTGTCCTTGG - Intronic
1125767722 15:42146335-42146357 CGACCCAAAGCCTCTCTTGTGGG - Intronic
1126396847 15:48227469-48227491 AGACCCACTGGCTCTCTCGCAGG + Intronic
1127472404 15:59302048-59302070 AGAACTAAAGCCTCTGTTGGAGG + Intronic
1127773918 15:62251187-62251209 AGACCCAAATCCTCTGTCCTTGG - Intergenic
1127775449 15:62260796-62260818 AGACCCAAATCCTCTGTCCTTGG - Intergenic
1129729568 15:77922225-77922247 AGACCCAAATCCTCTGTCCTTGG - Intergenic
1129838952 15:78731749-78731771 AGACCCAAATCCTCTGTCTTTGG + Intergenic
1132433424 15:101778394-101778416 AGACCCAAATCCTCTGTCCTTGG - Intergenic
1132615918 16:841003-841025 AAGCTCAAAGCCTCTTTCGGAGG - Intergenic
1136593021 16:31229103-31229125 AGACCCAAAGCCTCCTTCTGAGG + Intergenic
1138457982 16:57132244-57132266 AGACCCTCAGCCACTCTCTGGGG - Intronic
1140781723 16:78302968-78302990 AGACCCAGAGCCTTTCTCAGAGG + Intronic
1141410455 16:83829465-83829487 AGTCCCAAAGCCTCTGTCTGTGG - Intergenic
1141511188 16:84513291-84513313 AGACCTTAAGCCTGTTTCGGCGG + Intronic
1142787584 17:2236165-2236187 AGACCCAGAGCCTCTCCCAAGGG - Intronic
1143169255 17:4917681-4917703 AGACCCCAGGCATCTCTCTGGGG - Intergenic
1143238165 17:5420571-5420593 AGACAAAGTGCCTCTCTCGGTGG - Intronic
1144672079 17:17138524-17138546 AGTCCCCAAGCCTCCCTTGGCGG + Intronic
1145919195 17:28597925-28597947 AGTCCTAAAGCCTTTCTTGGAGG + Intronic
1146804524 17:35854795-35854817 AGAGCCAAAGCTTCTCTGGACGG - Intronic
1151657205 17:75501664-75501686 AGCCCCCAAGCCTGTGTCGGTGG - Exonic
1152646687 17:81472210-81472232 CGACCCAAAGCCAATCACGGTGG - Intergenic
1152936842 17:83143831-83143853 AGACCCAAAGCTGCTCTGTGAGG - Intergenic
1156228418 18:35131090-35131112 AGACCCAAAGCCTGGCTGAGTGG - Intronic
1162059191 19:8084539-8084561 AGACCCAAAGGATCTCTTTGGGG - Intronic
1166543589 19:43621309-43621331 AGACCCAGAGTCTCGCTGGGTGG - Intergenic
925504109 2:4541924-4541946 AGAGCCAAGGCATCTCTCTGGGG + Intergenic
927135217 2:20092009-20092031 AGACCCAAAGCATCTCCTGAAGG + Intergenic
928180239 2:29063459-29063481 AGAGTCATAGCCTCTCTCTGGGG + Exonic
931920688 2:67012199-67012221 AGACCCCAAGCCTCTCTATAGGG + Intergenic
945995132 2:216430112-216430134 ACACACAGAGCCTCTCTCAGGGG - Intronic
946804087 2:223452305-223452327 AGAAGCAAAGCCTCTGTCTGTGG + Intergenic
1170751136 20:19146723-19146745 AAACCAAAAGCCTCACTCTGAGG - Intergenic
1173617174 20:44410899-44410921 AGACCTGAAGCCCCTCTCTGTGG - Intronic
1174444356 20:50580472-50580494 AGACCCAAAGCATATTTTGGTGG + Intronic
1175811528 20:61860962-61860984 AGACCCAAAGGCACCCTGGGGGG - Intronic
1179492416 21:41749784-41749806 CGCCCCAAAGCCTTTTTCGGGGG + Intronic
1179983447 21:44908166-44908188 GGACCCAAAGCCGCTCCCTGTGG + Intronic
1181052926 22:20246242-20246264 TGACCCAGAGCCTCTCCCTGCGG + Intronic
1182021482 22:27085400-27085422 AGATCCAAGGGCTCTCTAGGAGG - Intergenic
1182587369 22:31352382-31352404 ACCCCCATAGCCTCTCTCTGAGG + Intergenic
1184461638 22:44641036-44641058 AGACTGCAAGCCTCTCCCGGGGG + Intergenic
1185247874 22:49782766-49782788 AGACCCAAAGCCCATCTTGCTGG + Intronic
1185247910 22:49782962-49782984 AGACCCAAAGCCCATCTTGCTGG + Intronic
950789626 3:15461881-15461903 AGTCCCAAACCCATTCTCGGGGG - Intronic
950942397 3:16905967-16905989 AGCCCAAAAGCCTCTCCAGGTGG - Intronic
951392884 3:22129352-22129374 AGGCCCAAGGCCTCTGTCAGCGG + Intronic
955728394 3:61957831-61957853 AGCCCAAAAGCCCCTCTCTGAGG - Intronic
957463108 3:80548169-80548191 AGGGACAAAGCCTCTCTCTGGGG + Intergenic
960277443 3:115744137-115744159 AGAGCAAAACCCTGTCTCGGGGG - Intergenic
960375126 3:116891491-116891513 ACACCCACACCCTCTCTCTGAGG - Intronic
961263955 3:125625298-125625320 AGACCCAAAGCCTTAGTCAGTGG + Intergenic
963200674 3:142582862-142582884 AGAGCCAAATCCTGTCTCAGAGG + Intergenic
963814105 3:149811322-149811344 AAACCCAAAGCTCCTCTCTGTGG + Intronic
971231646 4:24804940-24804962 ATTCCCAAAGCCTCTCTAGCTGG - Intergenic
973850618 4:54958046-54958068 AGAGCCAAAGCAGCTCTCTGGGG + Intergenic
982695598 4:158596090-158596112 AGAACAAAACCCTCTCTCAGAGG + Intronic
982941798 4:161568471-161568493 AGACCCAAAGCCACCTGCGGAGG - Intronic
985096148 4:186415038-186415060 AAACCCAAACCCTGTCACGGGGG - Intergenic
985570697 5:643313-643335 CGACCCAAAGCCCCGCGCGGAGG + Intronic
993138714 5:84002963-84002985 AGACACAAAGCCTCTGTCAGTGG - Intronic
996873378 5:128216158-128216180 AGACACAGAGCCTCACTCTGTGG - Intergenic
998034823 5:138906067-138906089 ATAAGTAAAGCCTCTCTCGGTGG + Intronic
1003639092 6:7861747-7861769 AGAACCAAAACCTTTCCCGGAGG + Intronic
1006132408 6:31877500-31877522 AGACCCACAGCCCCTCAGGGAGG + Intronic
1008506334 6:52234452-52234474 AGTCACAAAGCTTCTCTCTGTGG - Intergenic
1019919303 7:4152872-4152894 AGACCCAACCCCTCTCCCTGGGG - Intronic
1020561760 7:9736947-9736969 ACACCCAAAGCCTCTCTCCAAGG - Intergenic
1022113642 7:27245699-27245721 ACTCCCCAAACCTCTCTCGGAGG + Intronic
1022434688 7:30371693-30371715 AGACCCAAAACCTCTGGAGGCGG + Intronic
1023166675 7:37349809-37349831 TTACCCAAAGCCTATTTCGGTGG - Intronic
1023378330 7:39580525-39580547 AGGTCCAAGGCCTCTCTCAGTGG - Intronic
1030076149 7:105738784-105738806 AGACCCACAGCCTTTCTTGGAGG - Intronic
1030377507 7:108770627-108770649 AGAGACAAAGCCTTTCTGGGCGG + Intergenic
1035744146 8:1949786-1949808 GGAGCCACAGCCTTTCTCGGTGG + Intronic
1040014781 8:42691430-42691452 AAACCCAAAGCCTATCGTGGTGG + Intergenic
1049936135 9:503877-503899 AGACCCAACGCCTGCCTCGGGGG - Intronic
1059298161 9:113290946-113290968 AGACGCAACGCCGCTGTCGGAGG - Exonic
1060917022 9:127397666-127397688 AGGCCCAATGCCTGTCTCGTGGG - Intronic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1186233749 X:7484693-7484715 AGACCCAAAGAATCCCTTGGAGG + Intergenic
1187528080 X:20071941-20071963 AGACCCAAAGCCTGGCAGGGTGG - Intronic