ID: 1066437332

View in Genome Browser
Species Human (GRCh38)
Location 10:35406784-35406806
Sequence GCCGCCCCTACTGGGAAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437332_1066437355 28 Left 1066437332 10:35406784-35406806 CCTCACTTCCCAGTAGGGGCGGC No data
Right 1066437355 10:35406835-35406857 TGGGGCGGCTGGCCGGGCGGGGG No data
1066437332_1066437338 4 Left 1066437332 10:35406784-35406806 CCTCACTTCCCAGTAGGGGCGGC No data
Right 1066437338 10:35406811-35406833 CAGAGGCGCCCCTCACCTCCCGG No data
1066437332_1066437341 10 Left 1066437332 10:35406784-35406806 CCTCACTTCCCAGTAGGGGCGGC No data
Right 1066437341 10:35406817-35406839 CGCCCCTCACCTCCCGGATGGGG No data
1066437332_1066437339 8 Left 1066437332 10:35406784-35406806 CCTCACTTCCCAGTAGGGGCGGC No data
Right 1066437339 10:35406815-35406837 GGCGCCCCTCACCTCCCGGATGG No data
1066437332_1066437352 25 Left 1066437332 10:35406784-35406806 CCTCACTTCCCAGTAGGGGCGGC No data
Right 1066437352 10:35406832-35406854 GGATGGGGCGGCTGGCCGGGCGG No data
1066437332_1066437340 9 Left 1066437332 10:35406784-35406806 CCTCACTTCCCAGTAGGGGCGGC No data
Right 1066437340 10:35406816-35406838 GCGCCCCTCACCTCCCGGATGGG No data
1066437332_1066437353 26 Left 1066437332 10:35406784-35406806 CCTCACTTCCCAGTAGGGGCGGC No data
Right 1066437353 10:35406833-35406855 GATGGGGCGGCTGGCCGGGCGGG No data
1066437332_1066437350 22 Left 1066437332 10:35406784-35406806 CCTCACTTCCCAGTAGGGGCGGC No data
Right 1066437350 10:35406829-35406851 CCCGGATGGGGCGGCTGGCCGGG No data
1066437332_1066437356 29 Left 1066437332 10:35406784-35406806 CCTCACTTCCCAGTAGGGGCGGC No data
Right 1066437356 10:35406836-35406858 GGGGCGGCTGGCCGGGCGGGGGG No data
1066437332_1066437354 27 Left 1066437332 10:35406784-35406806 CCTCACTTCCCAGTAGGGGCGGC No data
Right 1066437354 10:35406834-35406856 ATGGGGCGGCTGGCCGGGCGGGG No data
1066437332_1066437346 17 Left 1066437332 10:35406784-35406806 CCTCACTTCCCAGTAGGGGCGGC No data
Right 1066437346 10:35406824-35406846 CACCTCCCGGATGGGGCGGCTGG No data
1066437332_1066437348 21 Left 1066437332 10:35406784-35406806 CCTCACTTCCCAGTAGGGGCGGC No data
Right 1066437348 10:35406828-35406850 TCCCGGATGGGGCGGCTGGCCGG No data
1066437332_1066437344 13 Left 1066437332 10:35406784-35406806 CCTCACTTCCCAGTAGGGGCGGC No data
Right 1066437344 10:35406820-35406842 CCCTCACCTCCCGGATGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066437332 Original CRISPR GCCGCCCCTACTGGGAAGTG AGG (reversed) Intronic