ID: 1066437337

View in Genome Browser
Species Human (GRCh38)
Location 10:35406806-35406828
Sequence AGGTGAGGGGCGCCTCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437337_1066437348 -1 Left 1066437337 10:35406806-35406828 CCAGGCAGAGGCGCCCCTCACCT No data
Right 1066437348 10:35406828-35406850 TCCCGGATGGGGCGGCTGGCCGG No data
1066437337_1066437354 5 Left 1066437337 10:35406806-35406828 CCAGGCAGAGGCGCCCCTCACCT No data
Right 1066437354 10:35406834-35406856 ATGGGGCGGCTGGCCGGGCGGGG No data
1066437337_1066437353 4 Left 1066437337 10:35406806-35406828 CCAGGCAGAGGCGCCCCTCACCT No data
Right 1066437353 10:35406833-35406855 GATGGGGCGGCTGGCCGGGCGGG No data
1066437337_1066437356 7 Left 1066437337 10:35406806-35406828 CCAGGCAGAGGCGCCCCTCACCT No data
Right 1066437356 10:35406836-35406858 GGGGCGGCTGGCCGGGCGGGGGG No data
1066437337_1066437344 -9 Left 1066437337 10:35406806-35406828 CCAGGCAGAGGCGCCCCTCACCT No data
Right 1066437344 10:35406820-35406842 CCCTCACCTCCCGGATGGGGCGG No data
1066437337_1066437355 6 Left 1066437337 10:35406806-35406828 CCAGGCAGAGGCGCCCCTCACCT No data
Right 1066437355 10:35406835-35406857 TGGGGCGGCTGGCCGGGCGGGGG No data
1066437337_1066437346 -5 Left 1066437337 10:35406806-35406828 CCAGGCAGAGGCGCCCCTCACCT No data
Right 1066437346 10:35406824-35406846 CACCTCCCGGATGGGGCGGCTGG No data
1066437337_1066437352 3 Left 1066437337 10:35406806-35406828 CCAGGCAGAGGCGCCCCTCACCT No data
Right 1066437352 10:35406832-35406854 GGATGGGGCGGCTGGCCGGGCGG No data
1066437337_1066437350 0 Left 1066437337 10:35406806-35406828 CCAGGCAGAGGCGCCCCTCACCT No data
Right 1066437350 10:35406829-35406851 CCCGGATGGGGCGGCTGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066437337 Original CRISPR AGGTGAGGGGCGCCTCTGCC TGG (reversed) Intronic