ID: 1066437342

View in Genome Browser
Species Human (GRCh38)
Location 10:35406819-35406841
Sequence CGCCCCATCCGGGAGGTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437342_1066437356 -6 Left 1066437342 10:35406819-35406841 CCCCTCACCTCCCGGATGGGGCG No data
Right 1066437356 10:35406836-35406858 GGGGCGGCTGGCCGGGCGGGGGG No data
1066437342_1066437366 26 Left 1066437342 10:35406819-35406841 CCCCTCACCTCCCGGATGGGGCG No data
Right 1066437366 10:35406868-35406890 CCCCACCTCCGTCCCCGTCGGGG No data
1066437342_1066437355 -7 Left 1066437342 10:35406819-35406841 CCCCTCACCTCCCGGATGGGGCG No data
Right 1066437355 10:35406835-35406857 TGGGGCGGCTGGCCGGGCGGGGG No data
1066437342_1066437354 -8 Left 1066437342 10:35406819-35406841 CCCCTCACCTCCCGGATGGGGCG No data
Right 1066437354 10:35406834-35406856 ATGGGGCGGCTGGCCGGGCGGGG No data
1066437342_1066437352 -10 Left 1066437342 10:35406819-35406841 CCCCTCACCTCCCGGATGGGGCG No data
Right 1066437352 10:35406832-35406854 GGATGGGGCGGCTGGCCGGGCGG No data
1066437342_1066437353 -9 Left 1066437342 10:35406819-35406841 CCCCTCACCTCCCGGATGGGGCG No data
Right 1066437353 10:35406833-35406855 GATGGGGCGGCTGGCCGGGCGGG No data
1066437342_1066437364 25 Left 1066437342 10:35406819-35406841 CCCCTCACCTCCCGGATGGGGCG No data
Right 1066437364 10:35406867-35406889 CCCCCACCTCCGTCCCCGTCGGG No data
1066437342_1066437369 29 Left 1066437342 10:35406819-35406841 CCCCTCACCTCCCGGATGGGGCG No data
Right 1066437369 10:35406871-35406893 CACCTCCGTCCCCGTCGGGGCGG No data
1066437342_1066437362 24 Left 1066437342 10:35406819-35406841 CCCCTCACCTCCCGGATGGGGCG No data
Right 1066437362 10:35406866-35406888 CCCCCCACCTCCGTCCCCGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066437342 Original CRISPR CGCCCCATCCGGGAGGTGAG GGG (reversed) Intronic