ID: 1066437347

View in Genome Browser
Species Human (GRCh38)
Location 10:35406826-35406848
Sequence GGCCAGCCGCCCCATCCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437347_1066437362 17 Left 1066437347 10:35406826-35406848 CCTCCCGGATGGGGCGGCTGGCC No data
Right 1066437362 10:35406866-35406888 CCCCCCACCTCCGTCCCCGTCGG No data
1066437347_1066437364 18 Left 1066437347 10:35406826-35406848 CCTCCCGGATGGGGCGGCTGGCC No data
Right 1066437364 10:35406867-35406889 CCCCCACCTCCGTCCCCGTCGGG No data
1066437347_1066437366 19 Left 1066437347 10:35406826-35406848 CCTCCCGGATGGGGCGGCTGGCC No data
Right 1066437366 10:35406868-35406890 CCCCACCTCCGTCCCCGTCGGGG No data
1066437347_1066437371 26 Left 1066437347 10:35406826-35406848 CCTCCCGGATGGGGCGGCTGGCC No data
Right 1066437371 10:35406875-35406897 TCCGTCCCCGTCGGGGCGGCCGG No data
1066437347_1066437369 22 Left 1066437347 10:35406826-35406848 CCTCCCGGATGGGGCGGCTGGCC No data
Right 1066437369 10:35406871-35406893 CACCTCCGTCCCCGTCGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066437347 Original CRISPR GGCCAGCCGCCCCATCCGGG AGG (reversed) Intronic