ID: 1066437351

View in Genome Browser
Species Human (GRCh38)
Location 10:35406830-35406852
Sequence GCCCGGCCAGCCGCCCCATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437351_1066437364 14 Left 1066437351 10:35406830-35406852 CCGGATGGGGCGGCTGGCCGGGC No data
Right 1066437364 10:35406867-35406889 CCCCCACCTCCGTCCCCGTCGGG No data
1066437351_1066437362 13 Left 1066437351 10:35406830-35406852 CCGGATGGGGCGGCTGGCCGGGC No data
Right 1066437362 10:35406866-35406888 CCCCCCACCTCCGTCCCCGTCGG No data
1066437351_1066437374 27 Left 1066437351 10:35406830-35406852 CCGGATGGGGCGGCTGGCCGGGC No data
Right 1066437374 10:35406880-35406902 CCCCGTCGGGGCGGCCGGCCAGG No data
1066437351_1066437366 15 Left 1066437351 10:35406830-35406852 CCGGATGGGGCGGCTGGCCGGGC No data
Right 1066437366 10:35406868-35406890 CCCCACCTCCGTCCCCGTCGGGG No data
1066437351_1066437371 22 Left 1066437351 10:35406830-35406852 CCGGATGGGGCGGCTGGCCGGGC No data
Right 1066437371 10:35406875-35406897 TCCGTCCCCGTCGGGGCGGCCGG No data
1066437351_1066437369 18 Left 1066437351 10:35406830-35406852 CCGGATGGGGCGGCTGGCCGGGC No data
Right 1066437369 10:35406871-35406893 CACCTCCGTCCCCGTCGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066437351 Original CRISPR GCCCGGCCAGCCGCCCCATC CGG (reversed) Intronic