ID: 1066437353

View in Genome Browser
Species Human (GRCh38)
Location 10:35406833-35406855
Sequence GATGGGGCGGCTGGCCGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437332_1066437353 26 Left 1066437332 10:35406784-35406806 CCTCACTTCCCAGTAGGGGCGGC No data
Right 1066437353 10:35406833-35406855 GATGGGGCGGCTGGCCGGGCGGG No data
1066437334_1066437353 18 Left 1066437334 10:35406792-35406814 CCCAGTAGGGGCGGCCAGGCAGA No data
Right 1066437353 10:35406833-35406855 GATGGGGCGGCTGGCCGGGCGGG No data
1066437335_1066437353 17 Left 1066437335 10:35406793-35406815 CCAGTAGGGGCGGCCAGGCAGAG No data
Right 1066437353 10:35406833-35406855 GATGGGGCGGCTGGCCGGGCGGG No data
1066437343_1066437353 -10 Left 1066437343 10:35406820-35406842 CCCTCACCTCCCGGATGGGGCGG No data
Right 1066437353 10:35406833-35406855 GATGGGGCGGCTGGCCGGGCGGG No data
1066437337_1066437353 4 Left 1066437337 10:35406806-35406828 CCAGGCAGAGGCGCCCCTCACCT No data
Right 1066437353 10:35406833-35406855 GATGGGGCGGCTGGCCGGGCGGG No data
1066437342_1066437353 -9 Left 1066437342 10:35406819-35406841 CCCCTCACCTCCCGGATGGGGCG No data
Right 1066437353 10:35406833-35406855 GATGGGGCGGCTGGCCGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066437353 Original CRISPR GATGGGGCGGCTGGCCGGGC GGG Intronic