ID: 1066437354

View in Genome Browser
Species Human (GRCh38)
Location 10:35406834-35406856
Sequence ATGGGGCGGCTGGCCGGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437345_1066437354 -10 Left 1066437345 10:35406821-35406843 CCTCACCTCCCGGATGGGGCGGC No data
Right 1066437354 10:35406834-35406856 ATGGGGCGGCTGGCCGGGCGGGG No data
1066437332_1066437354 27 Left 1066437332 10:35406784-35406806 CCTCACTTCCCAGTAGGGGCGGC No data
Right 1066437354 10:35406834-35406856 ATGGGGCGGCTGGCCGGGCGGGG No data
1066437335_1066437354 18 Left 1066437335 10:35406793-35406815 CCAGTAGGGGCGGCCAGGCAGAG No data
Right 1066437354 10:35406834-35406856 ATGGGGCGGCTGGCCGGGCGGGG No data
1066437337_1066437354 5 Left 1066437337 10:35406806-35406828 CCAGGCAGAGGCGCCCCTCACCT No data
Right 1066437354 10:35406834-35406856 ATGGGGCGGCTGGCCGGGCGGGG No data
1066437334_1066437354 19 Left 1066437334 10:35406792-35406814 CCCAGTAGGGGCGGCCAGGCAGA No data
Right 1066437354 10:35406834-35406856 ATGGGGCGGCTGGCCGGGCGGGG No data
1066437343_1066437354 -9 Left 1066437343 10:35406820-35406842 CCCTCACCTCCCGGATGGGGCGG No data
Right 1066437354 10:35406834-35406856 ATGGGGCGGCTGGCCGGGCGGGG No data
1066437342_1066437354 -8 Left 1066437342 10:35406819-35406841 CCCCTCACCTCCCGGATGGGGCG No data
Right 1066437354 10:35406834-35406856 ATGGGGCGGCTGGCCGGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066437354 Original CRISPR ATGGGGCGGCTGGCCGGGCG GGG Intronic