ID: 1066437356

View in Genome Browser
Species Human (GRCh38)
Location 10:35406836-35406858
Sequence GGGGCGGCTGGCCGGGCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437332_1066437356 29 Left 1066437332 10:35406784-35406806 CCTCACTTCCCAGTAGGGGCGGC No data
Right 1066437356 10:35406836-35406858 GGGGCGGCTGGCCGGGCGGGGGG No data
1066437335_1066437356 20 Left 1066437335 10:35406793-35406815 CCAGTAGGGGCGGCCAGGCAGAG No data
Right 1066437356 10:35406836-35406858 GGGGCGGCTGGCCGGGCGGGGGG No data
1066437337_1066437356 7 Left 1066437337 10:35406806-35406828 CCAGGCAGAGGCGCCCCTCACCT No data
Right 1066437356 10:35406836-35406858 GGGGCGGCTGGCCGGGCGGGGGG No data
1066437334_1066437356 21 Left 1066437334 10:35406792-35406814 CCCAGTAGGGGCGGCCAGGCAGA No data
Right 1066437356 10:35406836-35406858 GGGGCGGCTGGCCGGGCGGGGGG No data
1066437343_1066437356 -7 Left 1066437343 10:35406820-35406842 CCCTCACCTCCCGGATGGGGCGG No data
Right 1066437356 10:35406836-35406858 GGGGCGGCTGGCCGGGCGGGGGG No data
1066437345_1066437356 -8 Left 1066437345 10:35406821-35406843 CCTCACCTCCCGGATGGGGCGGC No data
Right 1066437356 10:35406836-35406858 GGGGCGGCTGGCCGGGCGGGGGG No data
1066437342_1066437356 -6 Left 1066437342 10:35406819-35406841 CCCCTCACCTCCCGGATGGGGCG No data
Right 1066437356 10:35406836-35406858 GGGGCGGCTGGCCGGGCGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066437356 Original CRISPR GGGGCGGCTGGCCGGGCGGG GGG Intronic