ID: 1066437357

View in Genome Browser
Species Human (GRCh38)
Location 10:35406847-35406869
Sequence GGGGGGGTCAGCCCCCCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7235
Summary {0: 3017, 1: 2791, 2: 995, 3: 232, 4: 200}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437357_1066437369 1 Left 1066437357 10:35406847-35406869 CCGGGCGGGGGGCTGACCCCCCC 0: 3017
1: 2791
2: 995
3: 232
4: 200
Right 1066437369 10:35406871-35406893 CACCTCCGTCCCCGTCGGGGCGG No data
1066437357_1066437366 -2 Left 1066437357 10:35406847-35406869 CCGGGCGGGGGGCTGACCCCCCC 0: 3017
1: 2791
2: 995
3: 232
4: 200
Right 1066437366 10:35406868-35406890 CCCCACCTCCGTCCCCGTCGGGG No data
1066437357_1066437371 5 Left 1066437357 10:35406847-35406869 CCGGGCGGGGGGCTGACCCCCCC 0: 3017
1: 2791
2: 995
3: 232
4: 200
Right 1066437371 10:35406875-35406897 TCCGTCCCCGTCGGGGCGGCCGG No data
1066437357_1066437381 26 Left 1066437357 10:35406847-35406869 CCGGGCGGGGGGCTGACCCCCCC 0: 3017
1: 2791
2: 995
3: 232
4: 200
Right 1066437381 10:35406896-35406918 GGCCAGGCAGAGGGGCTTTTTGG No data
1066437357_1066437378 17 Left 1066437357 10:35406847-35406869 CCGGGCGGGGGGCTGACCCCCCC 0: 3017
1: 2791
2: 995
3: 232
4: 200
Right 1066437378 10:35406887-35406909 GGGGCGGCCGGCCAGGCAGAGGG 0: 15
1: 179
2: 1700
3: 2073
4: 4455
1066437357_1066437377 16 Left 1066437357 10:35406847-35406869 CCGGGCGGGGGGCTGACCCCCCC 0: 3017
1: 2791
2: 995
3: 232
4: 200
Right 1066437377 10:35406886-35406908 CGGGGCGGCCGGCCAGGCAGAGG 0: 15
1: 218
2: 2558
3: 4748
4: 3746
1066437357_1066437362 -4 Left 1066437357 10:35406847-35406869 CCGGGCGGGGGGCTGACCCCCCC 0: 3017
1: 2791
2: 995
3: 232
4: 200
Right 1066437362 10:35406866-35406888 CCCCCCACCTCCGTCCCCGTCGG No data
1066437357_1066437374 10 Left 1066437357 10:35406847-35406869 CCGGGCGGGGGGCTGACCCCCCC 0: 3017
1: 2791
2: 995
3: 232
4: 200
Right 1066437374 10:35406880-35406902 CCCCGTCGGGGCGGCCGGCCAGG No data
1066437357_1066437364 -3 Left 1066437357 10:35406847-35406869 CCGGGCGGGGGGCTGACCCCCCC 0: 3017
1: 2791
2: 995
3: 232
4: 200
Right 1066437364 10:35406867-35406889 CCCCCACCTCCGTCCCCGTCGGG No data
1066437357_1066437379 18 Left 1066437357 10:35406847-35406869 CCGGGCGGGGGGCTGACCCCCCC 0: 3017
1: 2791
2: 995
3: 232
4: 200
Right 1066437379 10:35406888-35406910 GGGCGGCCGGCCAGGCAGAGGGG 0: 15
1: 198
2: 1740
3: 899
4: 1564

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066437357 Original CRISPR GGGGGGGTCAGCCCCCCGCC CGG (reversed) Intronic
Too many off-targets to display for this crispr