ID: 1066437363

View in Genome Browser
Species Human (GRCh38)
Location 10:35406867-35406889
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437363_1066437379 -2 Left 1066437363 10:35406867-35406889 CCCCCACCTCCGTCCCCGTCGGG No data
Right 1066437379 10:35406888-35406910 GGGCGGCCGGCCAGGCAGAGGGG No data
1066437363_1066437377 -4 Left 1066437363 10:35406867-35406889 CCCCCACCTCCGTCCCCGTCGGG No data
Right 1066437377 10:35406886-35406908 CGGGGCGGCCGGCCAGGCAGAGG No data
1066437363_1066437378 -3 Left 1066437363 10:35406867-35406889 CCCCCACCTCCGTCCCCGTCGGG No data
Right 1066437378 10:35406887-35406909 GGGGCGGCCGGCCAGGCAGAGGG No data
1066437363_1066437374 -10 Left 1066437363 10:35406867-35406889 CCCCCACCTCCGTCCCCGTCGGG No data
Right 1066437374 10:35406880-35406902 CCCCGTCGGGGCGGCCGGCCAGG No data
1066437363_1066437385 30 Left 1066437363 10:35406867-35406889 CCCCCACCTCCGTCCCCGTCGGG No data
Right 1066437385 10:35406920-35406942 GCTTTTTCTAATGTCGGGAGCGG No data
1066437363_1066437383 24 Left 1066437363 10:35406867-35406889 CCCCCACCTCCGTCCCCGTCGGG No data
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG No data
1066437363_1066437381 6 Left 1066437363 10:35406867-35406889 CCCCCACCTCCGTCCCCGTCGGG No data
Right 1066437381 10:35406896-35406918 GGCCAGGCAGAGGGGCTTTTTGG No data
1066437363_1066437384 25 Left 1066437363 10:35406867-35406889 CCCCCACCTCCGTCCCCGTCGGG No data
Right 1066437384 10:35406915-35406937 TTGGAGCTTTTTCTAATGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066437363 Original CRISPR CCCGACGGGGACGGAGGTGG GGG (reversed) Intronic