ID: 1066437366

View in Genome Browser
Species Human (GRCh38)
Location 10:35406868-35406890
Sequence CCCCACCTCCGTCCCCGTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437342_1066437366 26 Left 1066437342 10:35406819-35406841 CCCCTCACCTCCCGGATGGGGCG No data
Right 1066437366 10:35406868-35406890 CCCCACCTCCGTCCCCGTCGGGG No data
1066437345_1066437366 24 Left 1066437345 10:35406821-35406843 CCTCACCTCCCGGATGGGGCGGC No data
Right 1066437366 10:35406868-35406890 CCCCACCTCCGTCCCCGTCGGGG No data
1066437347_1066437366 19 Left 1066437347 10:35406826-35406848 CCTCCCGGATGGGGCGGCTGGCC No data
Right 1066437366 10:35406868-35406890 CCCCACCTCCGTCCCCGTCGGGG No data
1066437343_1066437366 25 Left 1066437343 10:35406820-35406842 CCCTCACCTCCCGGATGGGGCGG No data
Right 1066437366 10:35406868-35406890 CCCCACCTCCGTCCCCGTCGGGG No data
1066437349_1066437366 16 Left 1066437349 10:35406829-35406851 CCCGGATGGGGCGGCTGGCCGGG No data
Right 1066437366 10:35406868-35406890 CCCCACCTCCGTCCCCGTCGGGG No data
1066437357_1066437366 -2 Left 1066437357 10:35406847-35406869 CCGGGCGGGGGGCTGACCCCCCC No data
Right 1066437366 10:35406868-35406890 CCCCACCTCCGTCCCCGTCGGGG No data
1066437351_1066437366 15 Left 1066437351 10:35406830-35406852 CCGGATGGGGCGGCTGGCCGGGC No data
Right 1066437366 10:35406868-35406890 CCCCACCTCCGTCCCCGTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066437366 Original CRISPR CCCCACCTCCGTCCCCGTCG GGG Intronic