ID: 1066437367

View in Genome Browser
Species Human (GRCh38)
Location 10:35406869-35406891
Sequence GCCCCGACGGGGACGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437367_1066437383 22 Left 1066437367 10:35406869-35406891 CCCACCTCCGTCCCCGTCGGGGC No data
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG No data
1066437367_1066437385 28 Left 1066437367 10:35406869-35406891 CCCACCTCCGTCCCCGTCGGGGC No data
Right 1066437385 10:35406920-35406942 GCTTTTTCTAATGTCGGGAGCGG No data
1066437367_1066437381 4 Left 1066437367 10:35406869-35406891 CCCACCTCCGTCCCCGTCGGGGC No data
Right 1066437381 10:35406896-35406918 GGCCAGGCAGAGGGGCTTTTTGG No data
1066437367_1066437379 -4 Left 1066437367 10:35406869-35406891 CCCACCTCCGTCCCCGTCGGGGC No data
Right 1066437379 10:35406888-35406910 GGGCGGCCGGCCAGGCAGAGGGG No data
1066437367_1066437377 -6 Left 1066437367 10:35406869-35406891 CCCACCTCCGTCCCCGTCGGGGC No data
Right 1066437377 10:35406886-35406908 CGGGGCGGCCGGCCAGGCAGAGG No data
1066437367_1066437384 23 Left 1066437367 10:35406869-35406891 CCCACCTCCGTCCCCGTCGGGGC No data
Right 1066437384 10:35406915-35406937 TTGGAGCTTTTTCTAATGTCGGG No data
1066437367_1066437378 -5 Left 1066437367 10:35406869-35406891 CCCACCTCCGTCCCCGTCGGGGC No data
Right 1066437378 10:35406887-35406909 GGGGCGGCCGGCCAGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066437367 Original CRISPR GCCCCGACGGGGACGGAGGT GGG (reversed) Intronic