ID: 1066437368

View in Genome Browser
Species Human (GRCh38)
Location 10:35406870-35406892
Sequence CGCCCCGACGGGGACGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7612
Summary {0: 1, 1: 0, 2: 48, 3: 4016, 4: 3547}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437368_1066437384 22 Left 1066437368 10:35406870-35406892 CCACCTCCGTCCCCGTCGGGGCG 0: 1
1: 0
2: 48
3: 4016
4: 3547
Right 1066437384 10:35406915-35406937 TTGGAGCTTTTTCTAATGTCGGG 0: 36
1: 23
2: 59
3: 538
4: 376
1066437368_1066437379 -5 Left 1066437368 10:35406870-35406892 CCACCTCCGTCCCCGTCGGGGCG 0: 1
1: 0
2: 48
3: 4016
4: 3547
Right 1066437379 10:35406888-35406910 GGGCGGCCGGCCAGGCAGAGGGG 0: 15
1: 198
2: 1740
3: 899
4: 1564
1066437368_1066437385 27 Left 1066437368 10:35406870-35406892 CCACCTCCGTCCCCGTCGGGGCG 0: 1
1: 0
2: 48
3: 4016
4: 3547
Right 1066437385 10:35406920-35406942 GCTTTTTCTAATGTCGGGAGCGG No data
1066437368_1066437381 3 Left 1066437368 10:35406870-35406892 CCACCTCCGTCCCCGTCGGGGCG 0: 1
1: 0
2: 48
3: 4016
4: 3547
Right 1066437381 10:35406896-35406918 GGCCAGGCAGAGGGGCTTTTTGG No data
1066437368_1066437378 -6 Left 1066437368 10:35406870-35406892 CCACCTCCGTCCCCGTCGGGGCG 0: 1
1: 0
2: 48
3: 4016
4: 3547
Right 1066437378 10:35406887-35406909 GGGGCGGCCGGCCAGGCAGAGGG 0: 15
1: 179
2: 1700
3: 2073
4: 4455
1066437368_1066437383 21 Left 1066437368 10:35406870-35406892 CCACCTCCGTCCCCGTCGGGGCG 0: 1
1: 0
2: 48
3: 4016
4: 3547
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG 0: 27
1: 16
2: 55
3: 475
4: 380
1066437368_1066437377 -7 Left 1066437368 10:35406870-35406892 CCACCTCCGTCCCCGTCGGGGCG 0: 1
1: 0
2: 48
3: 4016
4: 3547
Right 1066437377 10:35406886-35406908 CGGGGCGGCCGGCCAGGCAGAGG 0: 15
1: 218
2: 2558
3: 4748
4: 3746

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066437368 Original CRISPR CGCCCCGACGGGGACGGAGG TGG (reversed) Intronic
Too many off-targets to display for this crispr