ID: 1066437370

View in Genome Browser
Species Human (GRCh38)
Location 10:35406873-35406895
Sequence GGCCGCCCCGACGGGGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4768
Summary {0: 1, 1: 0, 2: 3, 3: 104, 4: 4660}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437370_1066437386 29 Left 1066437370 10:35406873-35406895 CCTCCGTCCCCGTCGGGGCGGCC 0: 1
1: 0
2: 3
3: 104
4: 4660
Right 1066437386 10:35406925-35406947 TTCTAATGTCGGGAGCGGATTGG No data
1066437370_1066437383 18 Left 1066437370 10:35406873-35406895 CCTCCGTCCCCGTCGGGGCGGCC 0: 1
1: 0
2: 3
3: 104
4: 4660
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG 0: 27
1: 16
2: 55
3: 475
4: 380
1066437370_1066437384 19 Left 1066437370 10:35406873-35406895 CCTCCGTCCCCGTCGGGGCGGCC 0: 1
1: 0
2: 3
3: 104
4: 4660
Right 1066437384 10:35406915-35406937 TTGGAGCTTTTTCTAATGTCGGG 0: 36
1: 23
2: 59
3: 538
4: 376
1066437370_1066437387 30 Left 1066437370 10:35406873-35406895 CCTCCGTCCCCGTCGGGGCGGCC 0: 1
1: 0
2: 3
3: 104
4: 4660
Right 1066437387 10:35406926-35406948 TCTAATGTCGGGAGCGGATTGGG No data
1066437370_1066437385 24 Left 1066437370 10:35406873-35406895 CCTCCGTCCCCGTCGGGGCGGCC 0: 1
1: 0
2: 3
3: 104
4: 4660
Right 1066437385 10:35406920-35406942 GCTTTTTCTAATGTCGGGAGCGG No data
1066437370_1066437378 -9 Left 1066437370 10:35406873-35406895 CCTCCGTCCCCGTCGGGGCGGCC 0: 1
1: 0
2: 3
3: 104
4: 4660
Right 1066437378 10:35406887-35406909 GGGGCGGCCGGCCAGGCAGAGGG 0: 15
1: 179
2: 1700
3: 2073
4: 4455
1066437370_1066437379 -8 Left 1066437370 10:35406873-35406895 CCTCCGTCCCCGTCGGGGCGGCC 0: 1
1: 0
2: 3
3: 104
4: 4660
Right 1066437379 10:35406888-35406910 GGGCGGCCGGCCAGGCAGAGGGG 0: 15
1: 198
2: 1740
3: 899
4: 1564
1066437370_1066437377 -10 Left 1066437370 10:35406873-35406895 CCTCCGTCCCCGTCGGGGCGGCC 0: 1
1: 0
2: 3
3: 104
4: 4660
Right 1066437377 10:35406886-35406908 CGGGGCGGCCGGCCAGGCAGAGG 0: 15
1: 218
2: 2558
3: 4748
4: 3746
1066437370_1066437381 0 Left 1066437370 10:35406873-35406895 CCTCCGTCCCCGTCGGGGCGGCC 0: 1
1: 0
2: 3
3: 104
4: 4660
Right 1066437381 10:35406896-35406918 GGCCAGGCAGAGGGGCTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066437370 Original CRISPR GGCCGCCCCGACGGGGACGG AGG (reversed) Intronic
Too many off-targets to display for this crispr