ID: 1066437371

View in Genome Browser
Species Human (GRCh38)
Location 10:35406875-35406897
Sequence TCCGTCCCCGTCGGGGCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437347_1066437371 26 Left 1066437347 10:35406826-35406848 CCTCCCGGATGGGGCGGCTGGCC No data
Right 1066437371 10:35406875-35406897 TCCGTCCCCGTCGGGGCGGCCGG No data
1066437357_1066437371 5 Left 1066437357 10:35406847-35406869 CCGGGCGGGGGGCTGACCCCCCC No data
Right 1066437371 10:35406875-35406897 TCCGTCCCCGTCGGGGCGGCCGG No data
1066437351_1066437371 22 Left 1066437351 10:35406830-35406852 CCGGATGGGGCGGCTGGCCGGGC No data
Right 1066437371 10:35406875-35406897 TCCGTCCCCGTCGGGGCGGCCGG No data
1066437349_1066437371 23 Left 1066437349 10:35406829-35406851 CCCGGATGGGGCGGCTGGCCGGG No data
Right 1066437371 10:35406875-35406897 TCCGTCCCCGTCGGGGCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066437371 Original CRISPR TCCGTCCCCGTCGGGGCGGC CGG Intronic