ID: 1066437372

View in Genome Browser
Species Human (GRCh38)
Location 10:35406876-35406898
Sequence GCCGGCCGCCCCGACGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7310
Summary {0: 1, 1: 3, 2: 71, 3: 4210, 4: 3025}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437372_1066437387 27 Left 1066437372 10:35406876-35406898 CCGTCCCCGTCGGGGCGGCCGGC 0: 1
1: 3
2: 71
3: 4210
4: 3025
Right 1066437387 10:35406926-35406948 TCTAATGTCGGGAGCGGATTGGG No data
1066437372_1066437386 26 Left 1066437372 10:35406876-35406898 CCGTCCCCGTCGGGGCGGCCGGC 0: 1
1: 3
2: 71
3: 4210
4: 3025
Right 1066437386 10:35406925-35406947 TTCTAATGTCGGGAGCGGATTGG No data
1066437372_1066437384 16 Left 1066437372 10:35406876-35406898 CCGTCCCCGTCGGGGCGGCCGGC 0: 1
1: 3
2: 71
3: 4210
4: 3025
Right 1066437384 10:35406915-35406937 TTGGAGCTTTTTCTAATGTCGGG 0: 36
1: 23
2: 59
3: 538
4: 376
1066437372_1066437381 -3 Left 1066437372 10:35406876-35406898 CCGTCCCCGTCGGGGCGGCCGGC 0: 1
1: 3
2: 71
3: 4210
4: 3025
Right 1066437381 10:35406896-35406918 GGCCAGGCAGAGGGGCTTTTTGG No data
1066437372_1066437385 21 Left 1066437372 10:35406876-35406898 CCGTCCCCGTCGGGGCGGCCGGC 0: 1
1: 3
2: 71
3: 4210
4: 3025
Right 1066437385 10:35406920-35406942 GCTTTTTCTAATGTCGGGAGCGG No data
1066437372_1066437383 15 Left 1066437372 10:35406876-35406898 CCGTCCCCGTCGGGGCGGCCGGC 0: 1
1: 3
2: 71
3: 4210
4: 3025
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG 0: 27
1: 16
2: 55
3: 475
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066437372 Original CRISPR GCCGGCCGCCCCGACGGGGA CGG (reversed) Intronic
Too many off-targets to display for this crispr