ID: 1066437374

View in Genome Browser
Species Human (GRCh38)
Location 10:35406880-35406902
Sequence CCCCGTCGGGGCGGCCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437363_1066437374 -10 Left 1066437363 10:35406867-35406889 CCCCCACCTCCGTCCCCGTCGGG No data
Right 1066437374 10:35406880-35406902 CCCCGTCGGGGCGGCCGGCCAGG No data
1066437358_1066437374 -6 Left 1066437358 10:35406863-35406885 CCCCCCCCCACCTCCGTCCCCGT No data
Right 1066437374 10:35406880-35406902 CCCCGTCGGGGCGGCCGGCCAGG No data
1066437361_1066437374 -9 Left 1066437361 10:35406866-35406888 CCCCCCACCTCCGTCCCCGTCGG No data
Right 1066437374 10:35406880-35406902 CCCCGTCGGGGCGGCCGGCCAGG No data
1066437359_1066437374 -7 Left 1066437359 10:35406864-35406886 CCCCCCCCACCTCCGTCCCCGTC No data
Right 1066437374 10:35406880-35406902 CCCCGTCGGGGCGGCCGGCCAGG No data
1066437351_1066437374 27 Left 1066437351 10:35406830-35406852 CCGGATGGGGCGGCTGGCCGGGC No data
Right 1066437374 10:35406880-35406902 CCCCGTCGGGGCGGCCGGCCAGG No data
1066437357_1066437374 10 Left 1066437357 10:35406847-35406869 CCGGGCGGGGGGCTGACCCCCCC No data
Right 1066437374 10:35406880-35406902 CCCCGTCGGGGCGGCCGGCCAGG No data
1066437360_1066437374 -8 Left 1066437360 10:35406865-35406887 CCCCCCCACCTCCGTCCCCGTCG No data
Right 1066437374 10:35406880-35406902 CCCCGTCGGGGCGGCCGGCCAGG No data
1066437349_1066437374 28 Left 1066437349 10:35406829-35406851 CCCGGATGGGGCGGCTGGCCGGG No data
Right 1066437374 10:35406880-35406902 CCCCGTCGGGGCGGCCGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066437374 Original CRISPR CCCCGTCGGGGCGGCCGGCC AGG Intronic