ID: 1066437375

View in Genome Browser
Species Human (GRCh38)
Location 10:35406881-35406903
Sequence GCCTGGCCGGCCGCCCCGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437375_1066437385 16 Left 1066437375 10:35406881-35406903 CCCGTCGGGGCGGCCGGCCAGGC No data
Right 1066437385 10:35406920-35406942 GCTTTTTCTAATGTCGGGAGCGG No data
1066437375_1066437381 -8 Left 1066437375 10:35406881-35406903 CCCGTCGGGGCGGCCGGCCAGGC No data
Right 1066437381 10:35406896-35406918 GGCCAGGCAGAGGGGCTTTTTGG No data
1066437375_1066437384 11 Left 1066437375 10:35406881-35406903 CCCGTCGGGGCGGCCGGCCAGGC No data
Right 1066437384 10:35406915-35406937 TTGGAGCTTTTTCTAATGTCGGG No data
1066437375_1066437387 22 Left 1066437375 10:35406881-35406903 CCCGTCGGGGCGGCCGGCCAGGC No data
Right 1066437387 10:35406926-35406948 TCTAATGTCGGGAGCGGATTGGG No data
1066437375_1066437383 10 Left 1066437375 10:35406881-35406903 CCCGTCGGGGCGGCCGGCCAGGC No data
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG No data
1066437375_1066437386 21 Left 1066437375 10:35406881-35406903 CCCGTCGGGGCGGCCGGCCAGGC No data
Right 1066437386 10:35406925-35406947 TTCTAATGTCGGGAGCGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066437375 Original CRISPR GCCTGGCCGGCCGCCCCGAC GGG (reversed) Intronic