ID: 1066437376

View in Genome Browser
Species Human (GRCh38)
Location 10:35406882-35406904
Sequence TGCCTGGCCGGCCGCCCCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 151}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437376_1066437384 10 Left 1066437376 10:35406882-35406904 CCGTCGGGGCGGCCGGCCAGGCA 0: 1
1: 0
2: 1
3: 22
4: 151
Right 1066437384 10:35406915-35406937 TTGGAGCTTTTTCTAATGTCGGG 0: 36
1: 23
2: 59
3: 538
4: 376
1066437376_1066437381 -9 Left 1066437376 10:35406882-35406904 CCGTCGGGGCGGCCGGCCAGGCA 0: 1
1: 0
2: 1
3: 22
4: 151
Right 1066437381 10:35406896-35406918 GGCCAGGCAGAGGGGCTTTTTGG No data
1066437376_1066437385 15 Left 1066437376 10:35406882-35406904 CCGTCGGGGCGGCCGGCCAGGCA 0: 1
1: 0
2: 1
3: 22
4: 151
Right 1066437385 10:35406920-35406942 GCTTTTTCTAATGTCGGGAGCGG No data
1066437376_1066437387 21 Left 1066437376 10:35406882-35406904 CCGTCGGGGCGGCCGGCCAGGCA 0: 1
1: 0
2: 1
3: 22
4: 151
Right 1066437387 10:35406926-35406948 TCTAATGTCGGGAGCGGATTGGG No data
1066437376_1066437386 20 Left 1066437376 10:35406882-35406904 CCGTCGGGGCGGCCGGCCAGGCA 0: 1
1: 0
2: 1
3: 22
4: 151
Right 1066437386 10:35406925-35406947 TTCTAATGTCGGGAGCGGATTGG No data
1066437376_1066437383 9 Left 1066437376 10:35406882-35406904 CCGTCGGGGCGGCCGGCCAGGCA 0: 1
1: 0
2: 1
3: 22
4: 151
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG 0: 27
1: 16
2: 55
3: 475
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066437376 Original CRISPR TGCCTGGCCGGCCGCCCCGA CGG (reversed) Intronic
900428199 1:2590022-2590044 TCCCGGGCCGGCCGCCCCAAAGG - Exonic
900620807 1:3586824-3586846 TGCCGGGCCCGCCGGCCTGATGG + Intronic
902634474 1:17726108-17726130 TGCCTGGCAGGCAGCACCAAAGG + Intergenic
903633955 1:24799566-24799588 CGCCCGGCCAGCCGCCCCGTCGG + Intronic
903633980 1:24799615-24799637 CGCCCGGCCAGCCGCCCCGTCGG + Intronic
904839690 1:33364272-33364294 TGGCTGGCTGGCTGCCCCCAGGG - Intronic
906208365 1:43998947-43998969 TGGCTGGCGGGCCACCCAGAGGG + Intronic
906355931 1:45106150-45106172 TCTCTGCCCGGCCGCCCCGTCGG + Intronic
906742061 1:48192796-48192818 TGCCCAGCCAGCCGCCCCGTCGG + Intergenic
907402521 1:54233554-54233576 CGCCCGGCCAGCCGCCCCGTCGG + Intronic
907905665 1:58782483-58782505 GGCCAGGCCGGCCGCGCCGTAGG + Exonic
915165597 1:153946312-153946334 TTCCCGGCCGGCCGGCCCGCTGG + Exonic
915228615 1:154429399-154429421 TACCGGGCCGGCCGCCCAGCTGG + Exonic
920152208 1:203919294-203919316 TGCCTGGCCAGCCGCCCCATCGG - Intergenic
922565900 1:226601641-226601663 TGCCAGGCAGGCTTCCCCGAAGG - Intronic
923401059 1:233615329-233615351 TCCATGGCCGGGCGCCCCGCGGG - Intronic
923506814 1:234611236-234611258 TGGCTGGCCCGCCGTCCCGCAGG + Intergenic
1066437376 10:35406882-35406904 TGCCTGGCCGGCCGCCCCGACGG - Intronic
1069784275 10:70977844-70977866 TCCCTGCCTGGCCGCCCTGATGG + Intergenic
1070367345 10:75750271-75750293 TGCCCGGCCAGCCGCCCCGGCGG - Intronic
1072291792 10:93971003-93971025 CGCCCGGCCAGCCGCCCCGTCGG + Intergenic
1075128908 10:119722370-119722392 CGCCCGGCCAGCCGCCCCGTCGG + Intergenic
1075727688 10:124618883-124618905 AGCCTGGCCTGCAGCCCTGAGGG - Intronic
1076789754 10:132770563-132770585 AGCCTCGCTGGCCGCCCCGGTGG + Intronic
1076864231 10:133159554-133159576 TGCCTGGCCAGCCACACGGACGG + Intergenic
1077551617 11:3203049-3203071 TGCCTGCCCTGCCTGCCCGAGGG + Intergenic
1081872996 11:46391684-46391706 GGCCCGGCCGCCCGCCCCGCCGG - Intergenic
1083813988 11:65121757-65121779 TTCCTGGCCGGTCACCTCGAAGG + Exonic
1084249734 11:67888197-67888219 TGCCTGGCCGCTCCCCCTGAGGG + Intergenic
1085022611 11:73218743-73218765 GGCTTGGCCAGTCGCCCCGAGGG - Intronic
1085111887 11:73896950-73896972 CGCCCGGCCAGCCGCCCCGTCGG - Intronic
1085253286 11:75157649-75157671 TGCCAGGCCAGCTGCCCCAAAGG + Intronic
1089585513 11:119507770-119507792 CGCCCGGCCAGCCGCCCCGTCGG - Intergenic
1091290501 11:134436891-134436913 TGCCTGCACGGCTGCCCAGAGGG + Intergenic
1091616464 12:2053948-2053970 TGCCTGGCCAGCCGCGCGGGGGG + Intronic
1092187824 12:6493901-6493923 TGATTGGCCGGCCGCTCCGGCGG + Exonic
1095738854 12:45586214-45586236 TGCCTGGCCGGCCAACCGGCTGG - Intergenic
1095738915 12:45586452-45586474 TGCCTGGCCGGCCAACCGGCTGG - Intergenic
1097028477 12:56075758-56075780 CGCCCGGCCAGCCGCCCCGTCGG - Intergenic
1103733103 12:123041766-123041788 TGCCTGGCCTTCCTCCCTGAAGG - Intronic
1103807424 12:123584385-123584407 AGCCTGGACGGCGGCTCCGAAGG - Intergenic
1105854219 13:24360899-24360921 TGCCTGGACGGCTGCCCCAGAGG - Intergenic
1108330337 13:49378427-49378449 CGCCCGGCCAGCCGCCCCGTCGG + Intronic
1112420348 13:99242478-99242500 CGCCCGGCCAGCCGCCCCGTCGG - Intronic
1112420450 13:99242704-99242726 GGCCAGGCCAGCCGCCCCGTCGG - Intronic
1113792350 13:113035615-113035637 TTCGTGGCCGGCCGCCTCCATGG + Intronic
1115203024 14:30874281-30874303 TGGAGGGCCGGCGGCCCCGACGG - Intergenic
1116251043 14:42482652-42482674 GCCCTGGCCGGCCGCGCCGCCGG + Intergenic
1117716656 14:58588492-58588514 AGCCCGGCCAGCCGCCCCGTCGG + Intergenic
1118955624 14:70477776-70477798 CGCCCGGCCAGCCGCCCCGCCGG + Intergenic
1119254419 14:73184412-73184434 TGCCAGGCCAGCCGCCCCGTCGG - Intronic
1119436783 14:74602775-74602797 TGCCTGGCAGGCTGGCTCGAAGG - Intronic
1121050429 14:90816309-90816331 GGCCCGGCCGCCCGCCCCGCAGG + Exonic
1121369927 14:93347437-93347459 GCCCTGGCGGGGCGCCCCGACGG + Intronic
1121600674 14:95200615-95200637 TGCCTGGGCGGCTGGCCTGATGG - Intronic
1122973419 14:105161542-105161564 TGCCTGCCCGCCCGCCGAGAGGG + Intronic
1124220602 15:27847060-27847082 TGCCTGGCCTCCCTCCCTGAGGG + Intronic
1125868588 15:43076995-43077017 TGCCTGGCCAGCCGCCCCGTCGG + Intronic
1126295721 15:47133344-47133366 CGCCCGGCCGGCCGCCCCGTCGG + Intergenic
1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG + Intronic
1129428644 15:75481850-75481872 TGCCTGGCCAGCCGCCCCTCCGG + Intronic
1129520762 15:76184713-76184735 TGCCCGTCCTGCCGCCCCGGTGG + Intronic
1129844694 15:78762811-78762833 TCACTGCCCTGCCGCCCCGAGGG - Intronic
1131160621 15:90102519-90102541 TGCCGGGCCTGCCGCCCCATTGG + Intergenic
1132580102 16:680742-680764 GGCCCGGCCGGCCCCACCGAGGG + Intronic
1132666087 16:1081963-1081985 TGCAGGGCCGGCAGCCACGAGGG + Intergenic
1132708330 16:1255883-1255905 TGCCAGGCAGGCCCCGCCGAGGG - Intergenic
1132884844 16:2178198-2178220 CGGCTGGCCGGGCGTCCCGATGG + Exonic
1133073764 16:3264179-3264201 TCCCTGGCCCGGCGCCCCAAAGG + Intronic
1135639642 16:24109179-24109201 TGCCCGGCCAGCCGCCCCGTCGG - Intronic
1135737389 16:24943101-24943123 TGCCTGGCCAGCATCCCCAAAGG + Intronic
1136146643 16:28320304-28320326 TGCCAGGCGGGCCGCGCCGACGG + Exonic
1136590336 16:31214632-31214654 GGCCGGGCCCGCCGCCCCGCAGG - Intronic
1138043582 16:53698636-53698658 TGCCCGGCCAGCCGCCCCGTCGG + Intronic
1139433157 16:66921953-66921975 TGCCCGGCTGGCAGCTCCGAGGG + Exonic
1140453929 16:75093705-75093727 GGACTGGCCGGCTCCCCCGACGG - Intronic
1142136971 16:88455944-88455966 AGCCTGGCCGGTCGGCCCGATGG + Intronic
1142284178 16:89165042-89165064 GCCCTGGCCGGCCCCCCCAAAGG + Intergenic
1142957556 17:3531872-3531894 TCCCTGGTCAGCTGCCCCGAGGG - Intronic
1144128072 17:12220991-12221013 GGGCTAGCCGGCCGCTCCGAGGG - Intergenic
1144185061 17:12789480-12789502 TGGCTGGCCGGCTGGCCCGGCGG - Intergenic
1144625200 17:16840862-16840884 TTCCTGGCCGGCCCCCCAGGAGG - Intergenic
1144784401 17:17823726-17823748 TGCCCGGCCCGCAGCCCCGAAGG - Intronic
1144967973 17:19089590-19089612 GGCCTGCCCGCCCGCCCCGAGGG - Intergenic
1144979944 17:19162473-19162495 GGCCTGCCCGCCCGCCCCGAGGG + Intergenic
1144988278 17:19215759-19215781 GGCCTGCCCGCCCGCCCCGAGGG - Intronic
1145174142 17:20685207-20685229 TGCCCGGCCAGCCGCCCCATCGG + Intergenic
1145322275 17:21773551-21773573 GGCCTGGCTGGGAGCCCCGATGG + Intergenic
1147159531 17:38562204-38562226 AGCCCGGACGGCAGCCCCGACGG + Exonic
1148038804 17:44689797-44689819 TGCCTGACGGGCCGCGCCGCAGG + Intronic
1150641902 17:66954953-66954975 TGCCTGGCCGGCTGCCTTGCTGG - Intergenic
1151332081 17:73415966-73415988 TGCCTGGCCGGGCTGCCCGTGGG - Exonic
1151692194 17:75693549-75693571 TGCCAGGCCTGCCGCCCCACAGG + Intronic
1161085872 19:2334635-2334657 TCCCAGGCCGGGGGCCCCGAAGG + Exonic
1162780155 19:13002556-13002578 TCCCTGCCCGCCCGCCCCGCCGG - Intronic
1163441608 19:17324829-17324851 GGCCTGCCCGCCCGCCCCGTTGG + Exonic
1164081689 19:21865751-21865773 CGCCCGGCCAGCCGCCCCGTCGG - Intergenic
1164105915 19:22107469-22107491 CGCCTGGCCAGCCGCCCCGTCGG - Intergenic
1164620739 19:29694752-29694774 TGCCTGGCTGGCCCACCAGAGGG + Intergenic
1165349858 19:35269502-35269524 TGCCGGGCCGGCCGCGCCCGGGG + Intronic
1167074242 19:47239496-47239518 TGCAGGGCCGGCCACACCGAGGG - Intergenic
929516125 2:42605940-42605962 CGCCCGGCCAGCCGCCCCGTCGG - Intronic
929776762 2:44935068-44935090 AGCCTGGCGGGCGGCCCCCAAGG - Intergenic
931762572 2:65431157-65431179 TGCCTGGCCCGCGGGCCCGAGGG - Intronic
932396663 2:71453618-71453640 TGGCTGGGCGGCGGCCGCGATGG - Intergenic
934697405 2:96410041-96410063 TGCCTGGCGGGGAGCCCCAAGGG - Intergenic
936071483 2:109374484-109374506 TGCCTGTGCGGCCTCCCAGAGGG - Intronic
937261157 2:120587428-120587450 GGCCCGGCCCGCGGCCCCGAGGG + Intergenic
942754169 2:179319781-179319803 CGCCCGGCCAGCCGCCCCGTCGG - Intergenic
944585110 2:201166232-201166254 CGCCCGGCCAGCCGCCCCGTCGG - Exonic
948781442 2:240324178-240324200 TGCCCGGCCTGGGGCCCCGAAGG - Intergenic
949044760 2:241867300-241867322 TCCCTGCCCAGCCTCCCCGAAGG - Intergenic
1169195988 20:3682179-3682201 AGCCTGGCCAGGGGCCCCGACGG + Exonic
1172907306 20:38379071-38379093 TGCCCGGCCAGCCGCCCCGTCGG + Intergenic
1173273027 20:41555129-41555151 TGCCCGGCCAGCCGCCCCGTCGG - Intronic
1176195426 20:63834661-63834683 TGGCTGGCAGGGCCCCCCGAGGG + Intergenic
1178910390 21:36669002-36669024 GGCCTGGCCGGCCCCACCGCTGG + Intergenic
1180174996 21:46083041-46083063 TGCCTGCCCGGCTGCCCCCCAGG - Intergenic
1180189552 21:46155906-46155928 TGCCTGGAAGGCCTCCCAGAAGG - Intergenic
1180568368 22:16694650-16694672 TGCCAGGCCGGGAGCCTCGAAGG - Intergenic
1182331169 22:29552589-29552611 AGCCCGGCCAGCCGCCCCGTCGG + Intronic
1183685197 22:39357623-39357645 GGGCTGGCCGGCTGCTCCGAGGG - Intronic
1183685222 22:39357685-39357707 GGGCTGGCCGGCTGCTCCGAGGG - Intronic
1184368888 22:44070013-44070035 AGCCTGGCCGACCGTCACGATGG - Intronic
1184472190 22:44702280-44702302 TCCCGCGCCGGCCGCCCCGCCGG - Intronic
1184965408 22:47968272-47968294 TGCCTCTCCAGCAGCCCCGATGG + Intergenic
954316396 3:49803927-49803949 TGCCTGCCCGCCCGCCCTGGTGG + Intronic
954805465 3:53217423-53217445 TGCCTGGTTAGCCACCCCGAGGG - Intergenic
957063973 3:75506129-75506151 TGCCTGGCCGCTCCCCCTGAGGG + Intergenic
961289378 3:125833238-125833260 TGCCTGGCCGCTCCCCCTGAGGG - Intergenic
961306041 3:125959532-125959554 AGCCAGGCCAGCCGCCCCGGCGG + Intergenic
961897716 3:130182791-130182813 TGCCTGGCCGCTCCCCCTGAGGG + Intergenic
967896106 3:194397213-194397235 GGCCTGACCGCCCTCCCCGACGG - Exonic
968883755 4:3316205-3316227 TGCCTGGGCCGTCGCCCCCAAGG + Exonic
969969334 4:11029431-11029453 TGCCTGGCCCGCTGACCAGAGGG + Intergenic
972654100 4:41049262-41049284 TCTCTGCCCGGCCGCCCCGTCGG + Intronic
981524327 4:145694663-145694685 CGCCCGGCCAGCCGCCCCGTCGG + Intronic
984533468 4:180944876-180944898 TGCCCAGCCAGCCGCCCCGTCGG + Intergenic
984639187 4:182144307-182144329 TCCCTGGCCGGGCGTCCCGCGGG + Intronic
988572967 5:32390301-32390323 TGCCTGGTCGGACTCCCAGAAGG + Exonic
988734463 5:34007168-34007190 TGCCTGGCGGGCAGCCTTGACGG + Intronic
990952403 5:61311237-61311259 GCCCTGGCCGGCAGCCCCCAGGG + Intergenic
1005739215 6:28775133-28775155 TGCCTGGCCGCTCCCCCTGAGGG + Intergenic
1008092842 6:47309707-47309729 CGCCTGGGCGGCCGCGCCGCTGG - Exonic
1012983551 6:105853758-105853780 TGCCCGGCCAGCCGCCCCGTCGG - Intergenic
1012983629 6:105853936-105853958 TGCCCAGCCAGCCGCCCCGTCGG - Intergenic
1020096861 7:5374333-5374355 GGCCTGGCCGCCGGCCCCGCGGG - Exonic
1025000644 7:55312147-55312169 CGCCCGGCCAGCCGCCCCGTCGG + Intergenic
1026440034 7:70436293-70436315 TACCTGGCGGTCCGCCCGGATGG - Intronic
1032380017 7:131469219-131469241 TGGATGGCCGGCCGGCCAGACGG + Intronic
1034498403 7:151435339-151435361 TGACTGCCCGGCCGCCCCGTGGG - Intronic
1034969251 7:155408929-155408951 TGCCTGGCCCGGCGCCCCTCGGG + Intergenic
1035752081 8:2003024-2003046 TGCCTGAGAAGCCGCCCCGAGGG + Exonic
1036194158 8:6699466-6699488 GACCTGGCCGGCCACTCCGAGGG - Intergenic
1036249223 8:7147414-7147436 TGCCTGGCCGCTCCCCCTGAGGG + Intergenic
1041070874 8:54125635-54125657 CGCCCGGCCAGCCGCCCCGTCGG + Intergenic
1045298428 8:100892073-100892095 CGCCCGGCCAGCCGCCCCGTCGG - Intergenic
1049462131 8:142735111-142735133 TGCCTGGCCCGTCTCCCCTAGGG - Intronic
1049641738 8:143719056-143719078 TCCCTGGGCGACCTCCCCGAGGG + Exonic
1049808414 8:144551855-144551877 AGCCAGTCCGGCCTCCCCGATGG + Intronic
1052928752 9:34039204-34039226 CGCCCGGCCAGCCGCCCCGTTGG + Intronic
1056166871 9:83948443-83948465 CGCCCGGCCAGCCGCCCCGTCGG + Intronic
1058019089 9:100068535-100068557 CGCCCGGCCAGCCGCCCCGTCGG + Intronic
1062037645 9:134389829-134389851 AGCCTAGCCGGCAGCCCCCAGGG - Intronic
1062474664 9:136721073-136721095 TGGCTGGCAGCCCGCCCTGACGG + Intronic
1062514124 9:136923766-136923788 TGCCTGGCTGCCCTCCCCCAGGG - Intronic
1185584708 X:1235746-1235768 TGCCCGGCCAGCCGCCCCGTCGG + Intergenic
1185584807 X:1235943-1235965 CGCCCGGCCAGCCGCCCCGTCGG + Intergenic
1185584831 X:1235992-1236014 TGCCCGGCCAGCCGCCCCGTCGG + Intergenic
1186669478 X:11755440-11755462 TGCGTCGCCCGCCGCCCCGCTGG - Intergenic
1190505166 X:51119438-51119460 CACCTGGCCAGCCGCCCCGTCGG - Intergenic
1190873887 X:54446229-54446251 TGCTTGGCCGGGCGGGCCGAGGG - Exonic
1192107172 X:68327123-68327145 TGCCTGGCCAGCCGCCCGTCCGG + Intronic
1193114810 X:77766291-77766313 CGCCCGGCCAGCCGCCCCGTCGG - Intronic
1200070642 X:153527364-153527386 GGCCTGCCCAGCAGCCCCGAAGG - Intronic