ID: 1066437378

View in Genome Browser
Species Human (GRCh38)
Location 10:35406887-35406909
Sequence GGGGCGGCCGGCCAGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8422
Summary {0: 15, 1: 179, 2: 1700, 3: 2073, 4: 4455}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437359_1066437378 0 Left 1066437359 10:35406864-35406886 CCCCCCCCACCTCCGTCCCCGTC 0: 1
1: 0
2: 33
3: 1287
4: 2119
Right 1066437378 10:35406887-35406909 GGGGCGGCCGGCCAGGCAGAGGG 0: 15
1: 179
2: 1700
3: 2073
4: 4455
1066437365_1066437378 -4 Left 1066437365 10:35406868-35406890 CCCCACCTCCGTCCCCGTCGGGG 0: 1
1: 0
2: 58
3: 5067
4: 3416
Right 1066437378 10:35406887-35406909 GGGGCGGCCGGCCAGGCAGAGGG 0: 15
1: 179
2: 1700
3: 2073
4: 4455
1066437360_1066437378 -1 Left 1066437360 10:35406865-35406887 CCCCCCCACCTCCGTCCCCGTCG 0: 1
1: 0
2: 47
3: 3746
4: 2848
Right 1066437378 10:35406887-35406909 GGGGCGGCCGGCCAGGCAGAGGG 0: 15
1: 179
2: 1700
3: 2073
4: 4455
1066437368_1066437378 -6 Left 1066437368 10:35406870-35406892 CCACCTCCGTCCCCGTCGGGGCG 0: 1
1: 0
2: 48
3: 4016
4: 3547
Right 1066437378 10:35406887-35406909 GGGGCGGCCGGCCAGGCAGAGGG 0: 15
1: 179
2: 1700
3: 2073
4: 4455
1066437370_1066437378 -9 Left 1066437370 10:35406873-35406895 CCTCCGTCCCCGTCGGGGCGGCC 0: 1
1: 0
2: 3
3: 104
4: 4660
Right 1066437378 10:35406887-35406909 GGGGCGGCCGGCCAGGCAGAGGG 0: 15
1: 179
2: 1700
3: 2073
4: 4455
1066437357_1066437378 17 Left 1066437357 10:35406847-35406869 CCGGGCGGGGGGCTGACCCCCCC 0: 3017
1: 2791
2: 995
3: 232
4: 200
Right 1066437378 10:35406887-35406909 GGGGCGGCCGGCCAGGCAGAGGG 0: 15
1: 179
2: 1700
3: 2073
4: 4455
1066437358_1066437378 1 Left 1066437358 10:35406863-35406885 CCCCCCCCCACCTCCGTCCCCGT 0: 1
1: 1
2: 12
3: 450
4: 1610
Right 1066437378 10:35406887-35406909 GGGGCGGCCGGCCAGGCAGAGGG 0: 15
1: 179
2: 1700
3: 2073
4: 4455
1066437361_1066437378 -2 Left 1066437361 10:35406866-35406888 CCCCCCACCTCCGTCCCCGTCGG 0: 1
1: 0
2: 59
3: 4608
4: 3364
Right 1066437378 10:35406887-35406909 GGGGCGGCCGGCCAGGCAGAGGG 0: 15
1: 179
2: 1700
3: 2073
4: 4455
1066437363_1066437378 -3 Left 1066437363 10:35406867-35406889 CCCCCACCTCCGTCCCCGTCGGG 0: 1
1: 0
2: 62
3: 5118
4: 3550
Right 1066437378 10:35406887-35406909 GGGGCGGCCGGCCAGGCAGAGGG 0: 15
1: 179
2: 1700
3: 2073
4: 4455
1066437367_1066437378 -5 Left 1066437367 10:35406869-35406891 CCCACCTCCGTCCCCGTCGGGGC 0: 1
1: 0
2: 55
3: 4273
4: 3544
Right 1066437378 10:35406887-35406909 GGGGCGGCCGGCCAGGCAGAGGG 0: 15
1: 179
2: 1700
3: 2073
4: 4455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066437378 Original CRISPR GGGGCGGCCGGCCAGGCAGA GGG Intronic
Too many off-targets to display for this crispr