ID: 1066437379

View in Genome Browser
Species Human (GRCh38)
Location 10:35406888-35406910
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437360_1066437379 0 Left 1066437360 10:35406865-35406887 CCCCCCCACCTCCGTCCCCGTCG No data
Right 1066437379 10:35406888-35406910 GGGCGGCCGGCCAGGCAGAGGGG No data
1066437367_1066437379 -4 Left 1066437367 10:35406869-35406891 CCCACCTCCGTCCCCGTCGGGGC No data
Right 1066437379 10:35406888-35406910 GGGCGGCCGGCCAGGCAGAGGGG No data
1066437359_1066437379 1 Left 1066437359 10:35406864-35406886 CCCCCCCCACCTCCGTCCCCGTC No data
Right 1066437379 10:35406888-35406910 GGGCGGCCGGCCAGGCAGAGGGG No data
1066437370_1066437379 -8 Left 1066437370 10:35406873-35406895 CCTCCGTCCCCGTCGGGGCGGCC No data
Right 1066437379 10:35406888-35406910 GGGCGGCCGGCCAGGCAGAGGGG No data
1066437361_1066437379 -1 Left 1066437361 10:35406866-35406888 CCCCCCACCTCCGTCCCCGTCGG No data
Right 1066437379 10:35406888-35406910 GGGCGGCCGGCCAGGCAGAGGGG No data
1066437357_1066437379 18 Left 1066437357 10:35406847-35406869 CCGGGCGGGGGGCTGACCCCCCC No data
Right 1066437379 10:35406888-35406910 GGGCGGCCGGCCAGGCAGAGGGG No data
1066437363_1066437379 -2 Left 1066437363 10:35406867-35406889 CCCCCACCTCCGTCCCCGTCGGG No data
Right 1066437379 10:35406888-35406910 GGGCGGCCGGCCAGGCAGAGGGG No data
1066437365_1066437379 -3 Left 1066437365 10:35406868-35406890 CCCCACCTCCGTCCCCGTCGGGG No data
Right 1066437379 10:35406888-35406910 GGGCGGCCGGCCAGGCAGAGGGG No data
1066437368_1066437379 -5 Left 1066437368 10:35406870-35406892 CCACCTCCGTCCCCGTCGGGGCG No data
Right 1066437379 10:35406888-35406910 GGGCGGCCGGCCAGGCAGAGGGG No data
1066437358_1066437379 2 Left 1066437358 10:35406863-35406885 CCCCCCCCCACCTCCGTCCCCGT No data
Right 1066437379 10:35406888-35406910 GGGCGGCCGGCCAGGCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type