ID: 1066437381

View in Genome Browser
Species Human (GRCh38)
Location 10:35406896-35406918
Sequence GGCCAGGCAGAGGGGCTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437360_1066437381 8 Left 1066437360 10:35406865-35406887 CCCCCCCACCTCCGTCCCCGTCG 0: 1
1: 0
2: 47
3: 3746
4: 2848
Right 1066437381 10:35406896-35406918 GGCCAGGCAGAGGGGCTTTTTGG No data
1066437373_1066437381 -7 Left 1066437373 10:35406880-35406902 CCCCGTCGGGGCGGCCGGCCAGG 0: 1
1: 3
2: 20
3: 835
4: 9782
Right 1066437381 10:35406896-35406918 GGCCAGGCAGAGGGGCTTTTTGG No data
1066437376_1066437381 -9 Left 1066437376 10:35406882-35406904 CCGTCGGGGCGGCCGGCCAGGCA 0: 1
1: 0
2: 1
3: 22
4: 151
Right 1066437381 10:35406896-35406918 GGCCAGGCAGAGGGGCTTTTTGG No data
1066437357_1066437381 26 Left 1066437357 10:35406847-35406869 CCGGGCGGGGGGCTGACCCCCCC 0: 3017
1: 2791
2: 995
3: 232
4: 200
Right 1066437381 10:35406896-35406918 GGCCAGGCAGAGGGGCTTTTTGG No data
1066437361_1066437381 7 Left 1066437361 10:35406866-35406888 CCCCCCACCTCCGTCCCCGTCGG 0: 1
1: 0
2: 59
3: 4608
4: 3364
Right 1066437381 10:35406896-35406918 GGCCAGGCAGAGGGGCTTTTTGG No data
1066437367_1066437381 4 Left 1066437367 10:35406869-35406891 CCCACCTCCGTCCCCGTCGGGGC 0: 1
1: 0
2: 55
3: 4273
4: 3544
Right 1066437381 10:35406896-35406918 GGCCAGGCAGAGGGGCTTTTTGG No data
1066437372_1066437381 -3 Left 1066437372 10:35406876-35406898 CCGTCCCCGTCGGGGCGGCCGGC 0: 1
1: 3
2: 71
3: 4210
4: 3025
Right 1066437381 10:35406896-35406918 GGCCAGGCAGAGGGGCTTTTTGG No data
1066437363_1066437381 6 Left 1066437363 10:35406867-35406889 CCCCCACCTCCGTCCCCGTCGGG 0: 1
1: 0
2: 62
3: 5118
4: 3550
Right 1066437381 10:35406896-35406918 GGCCAGGCAGAGGGGCTTTTTGG No data
1066437365_1066437381 5 Left 1066437365 10:35406868-35406890 CCCCACCTCCGTCCCCGTCGGGG 0: 1
1: 0
2: 58
3: 5067
4: 3416
Right 1066437381 10:35406896-35406918 GGCCAGGCAGAGGGGCTTTTTGG No data
1066437375_1066437381 -8 Left 1066437375 10:35406881-35406903 CCCGTCGGGGCGGCCGGCCAGGC 0: 4
1: 13
2: 693
3: 5588
4: 7319
Right 1066437381 10:35406896-35406918 GGCCAGGCAGAGGGGCTTTTTGG No data
1066437370_1066437381 0 Left 1066437370 10:35406873-35406895 CCTCCGTCCCCGTCGGGGCGGCC 0: 1
1: 0
2: 3
3: 104
4: 4660
Right 1066437381 10:35406896-35406918 GGCCAGGCAGAGGGGCTTTTTGG No data
1066437368_1066437381 3 Left 1066437368 10:35406870-35406892 CCACCTCCGTCCCCGTCGGGGCG 0: 1
1: 0
2: 48
3: 4016
4: 3547
Right 1066437381 10:35406896-35406918 GGCCAGGCAGAGGGGCTTTTTGG No data
1066437358_1066437381 10 Left 1066437358 10:35406863-35406885 CCCCCCCCCACCTCCGTCCCCGT 0: 1
1: 1
2: 12
3: 450
4: 1610
Right 1066437381 10:35406896-35406918 GGCCAGGCAGAGGGGCTTTTTGG No data
1066437359_1066437381 9 Left 1066437359 10:35406864-35406886 CCCCCCCCACCTCCGTCCCCGTC 0: 1
1: 0
2: 33
3: 1287
4: 2119
Right 1066437381 10:35406896-35406918 GGCCAGGCAGAGGGGCTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066437381 Original CRISPR GGCCAGGCAGAGGGGCTTTT TGG Intronic
No off target data available for this crispr