ID: 1066437383

View in Genome Browser
Species Human (GRCh38)
Location 10:35406914-35406936
Sequence TTTGGAGCTTTTTCTAATGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437359_1066437383 27 Left 1066437359 10:35406864-35406886 CCCCCCCCACCTCCGTCCCCGTC No data
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG No data
1066437370_1066437383 18 Left 1066437370 10:35406873-35406895 CCTCCGTCCCCGTCGGGGCGGCC No data
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG No data
1066437375_1066437383 10 Left 1066437375 10:35406881-35406903 CCCGTCGGGGCGGCCGGCCAGGC No data
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG No data
1066437363_1066437383 24 Left 1066437363 10:35406867-35406889 CCCCCACCTCCGTCCCCGTCGGG No data
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG No data
1066437367_1066437383 22 Left 1066437367 10:35406869-35406891 CCCACCTCCGTCCCCGTCGGGGC No data
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG No data
1066437372_1066437383 15 Left 1066437372 10:35406876-35406898 CCGTCCCCGTCGGGGCGGCCGGC No data
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG No data
1066437361_1066437383 25 Left 1066437361 10:35406866-35406888 CCCCCCACCTCCGTCCCCGTCGG No data
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG No data
1066437376_1066437383 9 Left 1066437376 10:35406882-35406904 CCGTCGGGGCGGCCGGCCAGGCA No data
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG No data
1066437365_1066437383 23 Left 1066437365 10:35406868-35406890 CCCCACCTCCGTCCCCGTCGGGG No data
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG No data
1066437360_1066437383 26 Left 1066437360 10:35406865-35406887 CCCCCCCACCTCCGTCCCCGTCG No data
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG No data
1066437380_1066437383 -3 Left 1066437380 10:35406894-35406916 CCGGCCAGGCAGAGGGGCTTTTT No data
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG No data
1066437368_1066437383 21 Left 1066437368 10:35406870-35406892 CCACCTCCGTCCCCGTCGGGGCG No data
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG No data
1066437373_1066437383 11 Left 1066437373 10:35406880-35406902 CCCCGTCGGGGCGGCCGGCCAGG No data
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG No data
1066437382_1066437383 -7 Left 1066437382 10:35406898-35406920 CCAGGCAGAGGGGCTTTTTGGAG No data
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG No data
1066437358_1066437383 28 Left 1066437358 10:35406863-35406885 CCCCCCCCCACCTCCGTCCCCGT No data
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066437383 Original CRISPR TTTGGAGCTTTTTCTAATGT CGG Intronic