ID: 1066437383

View in Genome Browser
Species Human (GRCh38)
Location 10:35406914-35406936
Sequence TTTGGAGCTTTTTCTAATGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 953
Summary {0: 27, 1: 16, 2: 55, 3: 475, 4: 380}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437367_1066437383 22 Left 1066437367 10:35406869-35406891 CCCACCTCCGTCCCCGTCGGGGC 0: 1
1: 0
2: 55
3: 4273
4: 3544
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG 0: 27
1: 16
2: 55
3: 475
4: 380
1066437365_1066437383 23 Left 1066437365 10:35406868-35406890 CCCCACCTCCGTCCCCGTCGGGG 0: 1
1: 0
2: 58
3: 5067
4: 3416
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG 0: 27
1: 16
2: 55
3: 475
4: 380
1066437376_1066437383 9 Left 1066437376 10:35406882-35406904 CCGTCGGGGCGGCCGGCCAGGCA 0: 1
1: 0
2: 1
3: 22
4: 151
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG 0: 27
1: 16
2: 55
3: 475
4: 380
1066437361_1066437383 25 Left 1066437361 10:35406866-35406888 CCCCCCACCTCCGTCCCCGTCGG 0: 1
1: 0
2: 59
3: 4608
4: 3364
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG 0: 27
1: 16
2: 55
3: 475
4: 380
1066437372_1066437383 15 Left 1066437372 10:35406876-35406898 CCGTCCCCGTCGGGGCGGCCGGC 0: 1
1: 3
2: 71
3: 4210
4: 3025
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG 0: 27
1: 16
2: 55
3: 475
4: 380
1066437368_1066437383 21 Left 1066437368 10:35406870-35406892 CCACCTCCGTCCCCGTCGGGGCG 0: 1
1: 0
2: 48
3: 4016
4: 3547
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG 0: 27
1: 16
2: 55
3: 475
4: 380
1066437360_1066437383 26 Left 1066437360 10:35406865-35406887 CCCCCCCACCTCCGTCCCCGTCG 0: 1
1: 0
2: 47
3: 3746
4: 2848
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG 0: 27
1: 16
2: 55
3: 475
4: 380
1066437363_1066437383 24 Left 1066437363 10:35406867-35406889 CCCCCACCTCCGTCCCCGTCGGG 0: 1
1: 0
2: 62
3: 5118
4: 3550
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG 0: 27
1: 16
2: 55
3: 475
4: 380
1066437370_1066437383 18 Left 1066437370 10:35406873-35406895 CCTCCGTCCCCGTCGGGGCGGCC 0: 1
1: 0
2: 3
3: 104
4: 4660
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG 0: 27
1: 16
2: 55
3: 475
4: 380
1066437380_1066437383 -3 Left 1066437380 10:35406894-35406916 CCGGCCAGGCAGAGGGGCTTTTT 0: 1
1: 0
2: 2
3: 44
4: 256
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG 0: 27
1: 16
2: 55
3: 475
4: 380
1066437375_1066437383 10 Left 1066437375 10:35406881-35406903 CCCGTCGGGGCGGCCGGCCAGGC 0: 4
1: 13
2: 693
3: 5588
4: 7319
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG 0: 27
1: 16
2: 55
3: 475
4: 380
1066437382_1066437383 -7 Left 1066437382 10:35406898-35406920 CCAGGCAGAGGGGCTTTTTGGAG 0: 1
1: 0
2: 3
3: 15
4: 202
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG 0: 27
1: 16
2: 55
3: 475
4: 380
1066437373_1066437383 11 Left 1066437373 10:35406880-35406902 CCCCGTCGGGGCGGCCGGCCAGG 0: 1
1: 3
2: 20
3: 835
4: 9782
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG 0: 27
1: 16
2: 55
3: 475
4: 380
1066437358_1066437383 28 Left 1066437358 10:35406863-35406885 CCCCCCCCCACCTCCGTCCCCGT 0: 1
1: 1
2: 12
3: 450
4: 1610
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG 0: 27
1: 16
2: 55
3: 475
4: 380
1066437359_1066437383 27 Left 1066437359 10:35406864-35406886 CCCCCCCCACCTCCGTCCCCGTC 0: 1
1: 0
2: 33
3: 1287
4: 2119
Right 1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG 0: 27
1: 16
2: 55
3: 475
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066437383 Original CRISPR TTTGGAGCTTTTTCTAATGT CGG Intronic
900840758 1:5046896-5046918 TTTGGAGTTTTATTTAATGTCGG - Intergenic
900847444 1:5115167-5115189 TTTGGAGTTTTATTTAATGTCGG - Intergenic
901713227 1:11132105-11132127 TTAAAAGCTTTTCCTAATGTGGG - Intronic
901947782 1:12717679-12717701 TCTGTAGCTTGTTCTATTGTGGG - Intronic
902735369 1:18397273-18397295 TTTGGAGCTTCTTCACATGGTGG - Intergenic
903355615 1:22745569-22745591 TTTGAAGCTTTTTTTAATCGAGG - Intronic
904122013 1:28205175-28205197 TTTGGTGATTTTCCTAATGAGGG - Intronic
904393934 1:30205441-30205463 TTTGGAGCTTTTTCTAATGTTGG - Intergenic
904996507 1:34635619-34635641 TTTGGAGTTTTATTTAATGTTGG + Intergenic
905057395 1:35107651-35107673 TTTGGACATTTTTCTAATTCTGG - Intronic
905060546 1:35135992-35136014 TTTGGAGCTTTATTTAAAGTCGG + Intergenic
906080893 1:43087531-43087553 TTTGGAGTTTTATTTAATGTCGG - Intergenic
906627612 1:47338033-47338055 TTTGGAGGTTTTTTTCCTGTAGG + Intronic
906744549 1:48212651-48212673 TTTGGAGTTTTATTTAATGTCGG + Intergenic
907292603 1:53426318-53426340 TTTGGAGTTTTATTTAATGTCGG - Intergenic
907503595 1:54901522-54901544 TTTGGAGTTTTATTTAATGTCGG + Intergenic
907593962 1:55702808-55702830 TTCAGAGCTTTCTTTAATGTTGG + Intergenic
908148765 1:61277683-61277705 TTTGGAGTTGTTCCTACTGTGGG - Intronic
908461741 1:64353629-64353651 TTTGGAGTTTTATTTAATGTCGG + Intergenic
908852377 1:68388314-68388336 TTCGGAGTTTTATTTAATGTCGG - Intergenic
908920394 1:69184028-69184050 TGTGGAATTTTTTCCAATGTAGG + Intergenic
909014685 1:70369420-70369442 TTTGGAGCTTTATTTAATGTTGG - Intronic
909035444 1:70590329-70590351 TTTGGAGCTTTATTTCATGTCGG - Intergenic
909222686 1:72983494-72983516 TTTGGAGTTTTATTTAATGTCGG + Intergenic
909223679 1:72991445-72991467 TTTGGAGTTTTATTTAATGTCGG + Intergenic
909347741 1:74611930-74611952 TGTGGAACTTATTCTAATGGAGG - Intronic
909586273 1:77292201-77292223 TTTTGAATTTTGTCTAATGTTGG + Intronic
909776721 1:79492224-79492246 TTTGGAGTTTTATTTAATGTCGG + Intergenic
909793004 1:79700006-79700028 TTTGGAGTTTTATTTAATGTCGG + Intergenic
910493364 1:87797929-87797951 TTTGGAGTCTTTTCTGATGGTGG + Intergenic
910697357 1:90034053-90034075 TTTTGAGATTTTTCTAAGCTTGG - Intronic
911118876 1:94275161-94275183 TGTGGAGCTTGTTTTAAAGTTGG - Intergenic
911148016 1:94570546-94570568 TTTGGAGCTTTTTCTACTGTCGG + Intergenic
911376639 1:97059451-97059473 TTTGAACCTTTTTCTAATAAGGG + Intergenic
911510644 1:98804928-98804950 TTTGGAGCTTTATTTAACGTCGG + Intergenic
911570376 1:99511686-99511708 TTTGGAGTTTTATTTAATGTCGG - Intergenic
911759814 1:101601721-101601743 TTTGGAGTTTTATTTAATGTCGG + Intergenic
911966898 1:104382210-104382232 TTTGGAGCTTTTTGTAATGTTGG - Intergenic
912296449 1:108475000-108475022 TTTGGAGTTTTATTTAATGTCGG - Intergenic
912813534 1:112811462-112811484 TTTGGAGTTTTATTTAATGCCGG - Intergenic
912815340 1:112824171-112824193 TTTGGAGCTTTATTTAATGTCGG + Intergenic
913245102 1:116864153-116864175 TTTGGAGCTTTTTTTAGTGTTGG - Intergenic
913397961 1:118393470-118393492 TTTGTATCTTTTTCTAATAGTGG + Intergenic
914891809 1:151631593-151631615 TTTAAAGGTTTCTCTAATGTTGG + Intronic
916941766 1:169684889-169684911 TTTGGAGCTTTTTCTAATGTTGG - Intronic
917494607 1:175528988-175529010 GTTGGAGGTTGTTCTAATCTGGG - Intronic
918121070 1:181540899-181540921 TTTGGAGCATTTCCTGATTTTGG - Intronic
918347088 1:183615696-183615718 TTTGGAGTTTTATTTAATGTCGG - Intergenic
918545749 1:185681598-185681620 CTTGCAGCTTTCTCTAATATGGG - Intergenic
918567699 1:185951961-185951983 TTTGGAGTTTTATTTAATGTCGG + Intronic
918714434 1:187769158-187769180 TTTGGAGTTTTATTTAATGTCGG + Intergenic
918793731 1:188864540-188864562 TTGGCAGCTTTTTTAAATGTTGG + Intergenic
918805722 1:189040606-189040628 TTTCTGGCTTTTTCTCATGTTGG + Intergenic
919986551 1:202679750-202679772 TTTGGAGTTTTTTCCATTGAAGG - Intronic
920829377 1:209450985-209451007 TTTGGAGTTTTATTTAATGTCGG - Intergenic
920901556 1:210114474-210114496 TTTGGAGCTTTATTTAATATTGG + Intronic
921212392 1:212911554-212911576 TTTGGAGTTTTATTTAATGTCGG - Intergenic
921249925 1:213287905-213287927 TTTTGAACTTTTGTTAATGTGGG - Intergenic
921459808 1:215413605-215413627 TTTGGAGTTTTATTTAATGTCGG + Intergenic
921509231 1:216010055-216010077 TTTGGAGTTTTATTTAATGTCGG - Intronic
921520101 1:216147596-216147618 TTTGGAGTTTTATTTAATGTCGG - Intronic
921733002 1:218597454-218597476 TTTGGAGTTTTATTTAATGTCGG + Intergenic
921967096 1:221101800-221101822 TTTGGAGCTTTGTCCCATATTGG - Intergenic
922049561 1:221976768-221976790 TTTGGAGTTTTATTTAATGTCGG + Intergenic
922154097 1:223028068-223028090 TTTGGAGTTTTATTTAATGTCGG + Intergenic
922284421 1:224156543-224156565 ATTGGAGCATTTTGGAATGTGGG - Intronic
922598950 1:226835289-226835311 TTTGCAGCTTTTTCTAATATCGG - Intergenic
922877057 1:228948284-228948306 TTTGGAGTTTTATTTAATGTCGG - Intergenic
922906372 1:229176468-229176490 TTTGGAGTTTTATTTAATGTTGG - Intergenic
923075179 1:230603278-230603300 TTTGGAGTTTTATTTAATGTCGG - Intergenic
923244725 1:232120227-232120249 TTTGGAGTTTTATTTAATGTCGG - Intergenic
923257300 1:232232864-232232886 TTTGGAGTTTTATTTAATGTCGG + Intergenic
923770766 1:236935916-236935938 TTTGGAGTTTTATTTAATGTTGG + Intergenic
923962758 1:239103398-239103420 TTTGGAGTTTTATTTAATGTCGG - Intergenic
924180629 1:241436008-241436030 TTTGGAGTTTTATTTAATGTCGG - Intergenic
924357374 1:243195819-243195841 TTTGCAGCTTTTTAAAATATAGG - Intronic
1062930725 10:1350769-1350791 TTTGGAGTTTTATTTAATGTCGG - Intronic
1063363138 10:5473137-5473159 TTTGGAGCTTTATTTAATGTCGG - Intergenic
1063509627 10:6633257-6633279 TTTGGAGTTTTATTTAGTGTCGG + Intergenic
1063527710 10:6800754-6800776 TTTGGAGTTTTATTTAGTGTCGG + Intergenic
1063694258 10:8317572-8317594 TCTGGAAATGTTTCTAATGTAGG + Intergenic
1064663838 10:17630507-17630529 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1064887020 10:20122822-20122844 TTTGGAGTTTTATTTAGTGTCGG + Intronic
1065443146 10:25772402-25772424 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1066103424 10:32137345-32137367 TTTGGCACTTGTTCTAATGTTGG + Intergenic
1066437383 10:35406914-35406936 TTTGGAGCTTTTTCTAATGTCGG + Intronic
1067216798 10:44310451-44310473 TTTTAACCTTTTTCTACTGTGGG + Intergenic
1068592371 10:58864680-58864702 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1069104822 10:64370831-64370853 TCTGGAGCTATTTCAAATGTGGG - Intergenic
1069159584 10:65077634-65077656 ATTTGAACTTTTTCCAATGTAGG + Intergenic
1069642662 10:69965840-69965862 TTTGGTGCTTATTGTAAAGTAGG + Intergenic
1069792338 10:71030803-71030825 CTAGGAGCCTTTTCTATTGTGGG + Intergenic
1070474902 10:76820618-76820640 TTTGGAGTTTTACTTAATGTCGG - Intergenic
1070516589 10:77213898-77213920 TTTGGAGATTTCTCTGAGGTTGG - Intronic
1071821714 10:89286717-89286739 TTTGGAGTTTTATTTAATGTTGG - Intronic
1071897760 10:90084703-90084725 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1071916176 10:90297054-90297076 TTTGGAGTTTTATTTAATGTTGG - Intergenic
1071961085 10:90809475-90809497 TTTGGAGTTTTATTTAATGTTGG - Intronic
1072011306 10:91305176-91305198 TTTGGAGCTTTATTTCATGTTGG + Intergenic
1072074800 10:91959196-91959218 TTGGCATCTTTTTCCAATGTAGG + Intronic
1072296143 10:94011177-94011199 TTTGGAGCTTTTACTTATGATGG + Intronic
1072580233 10:96734261-96734283 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1073683507 10:105729413-105729435 TTTGGAGCTTTATTTAAAGTCGG - Intergenic
1073709512 10:106021282-106021304 TTTGGAGCTTTATTTAAAGTCGG + Intergenic
1073933184 10:108599855-108599877 TTTGGAGCTTTATTTAATGTCGG - Intergenic
1074297266 10:112201834-112201856 TTTGGTGCTTTTTCTATGATAGG - Intronic
1074539478 10:114352697-114352719 TTTCGACCTGTTTCTAGTGTTGG - Intronic
1074549748 10:114431420-114431442 TATGGAATTTTTTCAAATGTTGG - Intronic
1074740751 10:116482702-116482724 TTTGGAGTTTTATTTAATGTTGG - Intergenic
1075248671 10:120846898-120846920 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1077589906 11:3483324-3483346 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1077850823 11:6073500-6073522 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1077883325 11:6367835-6367857 TTTGGAGCTTTATTTAATGTCGG - Intergenic
1078046152 11:7915824-7915846 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1078305852 11:10185456-10185478 TTTGGGGCTTTTTTTAGAGTTGG + Intronic
1078635676 11:13047547-13047569 GCTGGAGGTTTTTCTAATATTGG - Intergenic
1078680590 11:13472071-13472093 TGTGGACCTTTATCTAATTTTGG - Intergenic
1078719243 11:13869341-13869363 TTTGGAGATTTTTCTGAGCTGGG - Intergenic
1078861825 11:15255418-15255440 TTTAGAGATTTTTCTGGTGTTGG - Intergenic
1079230488 11:18645052-18645074 TTTGGAGCTTTTTCTAATATTGG - Intergenic
1079447436 11:20569838-20569860 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1079672597 11:23187602-23187624 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1079727098 11:23890843-23890865 TTTGGAGTTTTATTTAATGTTGG + Intergenic
1079847720 11:25490909-25490931 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1079926564 11:26500910-26500932 TTTGGATTTTTCTCTAATTTAGG + Intronic
1080227330 11:29975431-29975453 TTTGAAGACTTTTTTAATGTTGG - Intergenic
1081356778 11:42122625-42122647 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1081824113 11:46030469-46030491 TTTGGATCTTTTTAAAATGCTGG - Intronic
1082755615 11:57073341-57073363 TCTGGAGCTTTATATAATCTTGG - Intergenic
1083287991 11:61673047-61673069 TTTGGAGCTTTTTCCAGTTTGGG - Intergenic
1084047138 11:66575645-66575667 TTTGGATTTTTATTTAATGTCGG - Intergenic
1084232276 11:67761733-67761755 TTTGGAGTTTTATTTAATGTAGG - Intergenic
1084245625 11:67855098-67855120 TTTGGAATTTTATTTAATGTCGG + Intergenic
1084355524 11:68635760-68635782 TTTGGAGTTTTATTTAATGTTGG - Intergenic
1084613303 11:70217966-70217988 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1085365699 11:75941597-75941619 TTTGGAGCATTTTTGAATTTTGG + Intronic
1085934242 11:81123873-81123895 TTTGGAGCTTTATTTAAAGTTGG - Intergenic
1085987988 11:81808237-81808259 TTTGGAGTTTTATTTAATGTTGG - Intergenic
1086004990 11:82027242-82027264 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1086134866 11:83435271-83435293 TTTGGAGCTTTATTTAATGTCGG + Intergenic
1086136301 11:83446593-83446615 TTTGGAGTTTTATTTAATGTTGG + Intergenic
1086550179 11:88045213-88045235 TTTGGAGCTTTATTTAATGTCGG - Intergenic
1086886963 11:92217313-92217335 TTTGGAGTTTTTGCCAAAGTAGG + Intergenic
1086906545 11:92424759-92424781 TTTGAATTTTTTTCTAATTTTGG + Intronic
1087099071 11:94347743-94347765 TTTGGAGTTTTATTTAATGTTGG - Intergenic
1087099613 11:94351674-94351696 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1087127792 11:94643666-94643688 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1087140627 11:94762277-94762299 TTGGGAGCTTCTTTTAAAGTGGG + Intronic
1087196890 11:95311579-95311601 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1087314652 11:96589973-96589995 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1087381200 11:97407480-97407502 TATGAAGCTTTTTGTAATGAAGG + Intergenic
1087493130 11:98852914-98852936 ATTGGAACTTTTATTAATGTAGG - Intergenic
1087839568 11:102907769-102907791 TTTGGAGTTTTATTTAATGTTGG + Intergenic
1088554932 11:111052216-111052238 TTTGGAGCTTTATTTCATGTCGG - Intergenic
1089349069 11:117811331-117811353 TTTGGAGTTTTATTTAATGTCGG - Intronic
1089439797 11:118505749-118505771 TTTAGATCTTTTTATGATGTTGG - Exonic
1089471082 11:118720662-118720684 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1089867079 11:121641611-121641633 TTTGGAGCTTTCTTTCATGTTGG + Intergenic
1089917039 11:122167362-122167384 TTTGGAATGTTTTCGAATGTAGG + Intergenic
1090107628 11:123869288-123869310 TTTGGAGTTTTATTTAATGTTGG + Intergenic
1090327484 11:125902019-125902041 TTTGGAGACTTTGGTAATGTTGG - Intronic
1090526837 11:127546422-127546444 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1090546516 11:127772766-127772788 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1090850623 11:130568026-130568048 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1090871983 11:130757169-130757191 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1090926965 11:131258149-131258171 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1091183646 11:133628834-133628856 TTTGGAGTTTTATTTAATGTTGG - Intergenic
1091886486 12:4020579-4020601 TTTGGAGTTTTATTTAATGTTGG - Intergenic
1091920690 12:4302396-4302418 CTTGGAGCTTTTTCAAAAGCGGG + Exonic
1092416205 12:8292229-8292251 TTTGGAGTTTTATTTAACGTCGG + Intergenic
1092474462 12:8806986-8807008 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1092592781 12:9966757-9966779 TTTGGAGTTTTATTTAATGTCGG + Intronic
1092681946 12:10992990-10993012 TTTTGAGTTTTTTGTCATGTCGG - Intronic
1092739351 12:11613358-11613380 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1092789682 12:12060441-12060463 TTTGGAGTTTTATTTAATGTCGG - Intronic
1092924878 12:13263634-13263656 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1093024303 12:14232601-14232623 TTTGGAGCTTTTTGTAACGTCGG - Intergenic
1093071189 12:14708533-14708555 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1093268038 12:17025367-17025389 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1093322017 12:17723963-17723985 TTTGGAGTTTTACATAATGTCGG + Intergenic
1093358403 12:18196977-18196999 TTTGGAGTTTTATTTAATGTAGG - Intronic
1093578791 12:20765425-20765447 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1094067191 12:26373772-26373794 ACTGGAACTTTTTCAAATGTTGG + Intronic
1095950412 12:47778814-47778836 TCTGCAGGTTTCTCTAATGTTGG + Intronic
1096345255 12:50840773-50840795 ATTGAAGATTTTTCTAAGGTGGG + Intergenic
1096419366 12:51443448-51443470 TTTGGAACGTGTTCTGATGTTGG - Intronic
1096710863 12:53454400-53454422 TTTGAAGCTTTTTCTGCTGAAGG + Intronic
1096907210 12:54946590-54946612 TTTGGAGCTTTATTTAATGTTGG + Intergenic
1097216537 12:57418220-57418242 TTTGGAGATTGTTTAAATGTGGG - Intronic
1097398559 12:59103888-59103910 TTTGGGGTTTTATTTAATGTCGG - Intergenic
1097417082 12:59326882-59326904 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1097542226 12:60955674-60955696 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1098173667 12:67770311-67770333 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1098402220 12:70087448-70087470 TTTGGAGTTTTATTTAATGTTGG - Intergenic
1098860696 12:75706800-75706822 TTAAGAGCTTTCTCTAAAGTAGG + Intergenic
1099188688 12:79541908-79541930 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1099272585 12:80529830-80529852 TTCGAAGCTTTTTCTAATTTAGG - Intronic
1099292128 12:80786740-80786762 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1099762559 12:86940848-86940870 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1099836125 12:87911075-87911097 TTTGGAGTTTTATTTAATGTTGG + Intergenic
1100275162 12:93065125-93065147 TGTGTATCTTTTTCTAATGGTGG - Intergenic
1100561321 12:95751138-95751160 TTTGGAGTTTTATTTAATGTCGG - Intronic
1100940262 12:99717209-99717231 TTTGGAGTTTTATTTAATGTTGG - Intronic
1101103406 12:101417601-101417623 TTTTGATCTTTTTCTATTTTGGG + Intergenic
1101278426 12:103226343-103226365 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1101566773 12:105913394-105913416 TTTGGAACTAATGCTAATGTTGG - Intergenic
1102260887 12:111442686-111442708 GCTTGAGCTTTTTCTAAGGTGGG - Intronic
1102588063 12:113937055-113937077 CTTGGAGCTTTTTCTTCTGTGGG + Exonic
1103389958 12:120565050-120565072 ATTGGTCCTTTTTCCAATGTAGG + Exonic
1105295190 13:19082759-19082781 TTTGTTCCTTTTTCTAAGGTTGG - Intergenic
1105701401 13:22938036-22938058 TTTGGAGCTTTTTCCGTTGGTGG + Intergenic
1106943417 13:34800692-34800714 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1107062667 13:36176352-36176374 TTCGAACATTTTTCTAATGTTGG - Intronic
1107220323 13:37972864-37972886 TTTGGAGTTCTATTTAATGTCGG + Intergenic
1107241092 13:38235076-38235098 TTTGGCTCTTTGTCTATTGTTGG - Intergenic
1107509488 13:41068806-41068828 TTAGGATTTTTATCTAATGTTGG + Intronic
1107681514 13:42856642-42856664 TTTGGTGCCTTTTCTAATAAGGG - Intergenic
1108232148 13:48357211-48357233 TTGGGAACATTTTCTTATGTTGG + Intronic
1108282095 13:48870812-48870834 TTTGGAGCTTTTTCTAATATCGG + Intergenic
1108512967 13:51171916-51171938 TTTGGAGTTTTATTTAATATCGG - Intergenic
1108803903 13:54131380-54131402 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1108814100 13:54268906-54268928 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1108913447 13:55581908-55581930 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1108919572 13:55658637-55658659 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1108947410 13:56042360-56042382 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1108952973 13:56116081-56116103 TTTGGAGTTTTACTTAATGTCGG + Intergenic
1109035380 13:57252370-57252392 TTTCCAGCTTTTTCTATTATGGG + Intergenic
1109352887 13:61206809-61206831 TTTGGAGTTTTATTTGATGTCGG - Intergenic
1109499269 13:63215172-63215194 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1109709693 13:66145000-66145022 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1109716770 13:66230039-66230061 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1110588882 13:77230494-77230516 TTTGGAGTTTGTTCAAATTTTGG + Intronic
1110790968 13:79586354-79586376 TTTTGAGCTTTTTCTCATAGGGG + Intergenic
1110800721 13:79691498-79691520 TTTGAAATTTTTTTTAATGTAGG + Intergenic
1110842686 13:80160809-80160831 TTTGGATCATTTTCTACTTTTGG - Intergenic
1110957207 13:81569230-81569252 ATTAGAGCTTTTTCAAATGTAGG + Intergenic
1111250205 13:85591659-85591681 TTTGGAGATTATTTTAATATGGG - Intergenic
1111302021 13:86360455-86360477 TTTTGAGTTTTATTTAATGTCGG - Intergenic
1111497210 13:89067789-89067811 TTTTGAACTTTTTCTATTTTGGG - Intergenic
1111594539 13:90395083-90395105 TTTGGATCTTTTGGGAATGTTGG + Intergenic
1111631733 13:90852250-90852272 TTTGGAGTTTTATTTAATGTGGG + Intergenic
1111769629 13:92580619-92580641 CAGGGAGCTTTTTCTAATGGTGG + Intronic
1111902622 13:94218565-94218587 TTTGCAACTCTTTCTGATGTGGG + Intronic
1112236801 13:97644366-97644388 TTTGGAGTTTTATTTAATATCGG - Intergenic
1112889347 13:104211741-104211763 TTTGGAGTTTTATTTAATATCGG + Intergenic
1113270614 13:108669488-108669510 TTAAGAGCTTTTTTTAATGATGG + Intronic
1113324309 13:109267392-109267414 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1113456985 13:110456365-110456387 TTTTGATCTTTTTCTGATATGGG - Intronic
1114771074 14:25429370-25429392 TTTGGAGCTTTTTCTAATGTCGG + Intergenic
1114831509 14:26148169-26148191 TGTTGAGCTTTTTTTCATGTTGG - Intergenic
1115197757 14:30819954-30819976 TTTTAAACATTTTCTAATGTAGG - Intergenic
1115895955 14:38087382-38087404 TTTGGAGCTTATGCTAGTGGAGG + Intergenic
1115904781 14:38192840-38192862 TTTGGAGTTTTATTTAATATCGG - Intergenic
1116048948 14:39780615-39780637 TTTCTGGCTTTTTCTAATTTGGG + Intergenic
1116179650 14:41517991-41518013 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1116360211 14:43984934-43984956 TGTGGAGACTTTTCTAAAGTTGG + Intergenic
1116490615 14:45499072-45499094 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1116534805 14:46016067-46016089 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1116573429 14:46545976-46545998 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1116613485 14:47106230-47106252 TTTGGAGTTTTATTTAATGTCGG - Intronic
1116702434 14:48259070-48259092 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1116952885 14:50895220-50895242 TTTGGAGTTTTATTTAATGTCGG - Intronic
1117237384 14:53792647-53792669 TTTGTACCTTTTTCTAAAGTAGG + Intergenic
1117801153 14:59446083-59446105 TTTGGAGTTTTATTTAATGTCGG - Intronic
1117957943 14:61137112-61137134 TTTGGAGTTTTATTTAATTTTGG + Intergenic
1118513518 14:66502866-66502888 TATGGAGCTTTTGCTTATGTAGG + Intergenic
1118918280 14:70126765-70126787 TTTGGAGCATTTTCAATTTTGGG - Intronic
1119022402 14:71126351-71126373 TTTGGAGTTTTATTTAATGCCGG - Intergenic
1119317172 14:73705540-73705562 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1120379973 14:83764829-83764851 CTTAGAGCTTTTTCTAAGCTAGG + Intergenic
1120438077 14:84503868-84503890 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1120539592 14:85736663-85736685 ATTGGAGTTTTATTTAATGTCGG + Intergenic
1121193331 14:92048399-92048421 TTTGGAGCTTTTTCTAATGTCGG + Exonic
1121703620 14:95974970-95974992 TTTGGAGTTTTATTTAATGTTGG - Intergenic
1121782773 14:96632672-96632694 TCTGTAGCTTTTTATAATTTAGG + Intergenic
1122095866 14:99371234-99371256 CTTGGAGATTTTTCTATTTTAGG + Intergenic
1122381348 14:101309334-101309356 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1123882520 15:24689242-24689264 TTTGGAGCTTTATTTAAAGTTGG + Intergenic
1124601164 15:31133854-31133876 TCTGGAGCTTTTCCTCAAGTGGG + Intronic
1124785568 15:32676530-32676552 TTTGAAGCTTTATATAATGTTGG - Intronic
1125045748 15:35240819-35240841 TTTGGAGTTTTATTTAATGTCGG - Intronic
1125213250 15:37239886-37239908 TTTGGAGCTTTATTTAATGTCGG + Intergenic
1125345831 15:38717717-38717739 TTTGTATCTATTTCTAATGAAGG + Intergenic
1125836099 15:42752996-42753018 TTTGTTACTTTCTCTAATGTTGG + Exonic
1125849067 15:42886575-42886597 TTTTGGAGTTTTTCTAATGTCGG - Intronic
1126530182 15:49702799-49702821 TTTGGAGCTTTATTTAAAGTCGG + Intergenic
1126648937 15:50902380-50902402 TATGGAGATCTTTCAAATGTTGG + Intergenic
1126912431 15:53430496-53430518 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1127296412 15:57612582-57612604 TTTGGAGCTTGTTGCATTGTAGG + Intronic
1128139379 15:65287632-65287654 TTTGGGGTTTTCTCTAATGAAGG - Intronic
1129670539 15:77605546-77605568 TTTGGAGAGCTTTCTATTGTGGG + Intergenic
1130304528 15:82704274-82704296 TTTGGAGTTTTATTTAATGTTGG - Intronic
1130945972 15:88551164-88551186 TTTGGAGCTTTATTTAATGACGG + Intergenic
1131164841 15:90134845-90134867 TTTGGAGCTTTATCTAACGTCGG - Intergenic
1131447717 15:92513533-92513555 TTTGGAGTTTTATTTACTGTTGG - Intergenic
1131684151 15:94752797-94752819 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1131684677 15:94756500-94756522 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1131882543 15:96875495-96875517 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1132073231 15:98798140-98798162 TGTGGAGCTTTTATTAAAGTAGG + Intronic
1132262986 15:100442309-100442331 TTTGGAGTTTTATTTAATGTTGG - Intronic
1132340385 15:101074586-101074608 TTTGGAGTTTTATTTAATGTAGG - Intronic
1133610122 16:7425690-7425712 TTTGGAGCTTTTGCCCAGGTAGG - Intronic
1133651371 16:7816753-7816775 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1133765765 16:8836676-8836698 TTTGGAGTTTTATTTAATGTCGG + Intronic
1133766789 16:8843743-8843765 TTTGGAGTTTTATTTAATGTCGG + Intronic
1134342207 16:13356230-13356252 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1135353139 16:21746872-21746894 TTTTGAGCTTTTTGTAATCACGG + Intronic
1135451626 16:22562995-22563017 TTTTGAGCTTTTTGTAATCACGG + Intergenic
1137726848 16:50662470-50662492 TTTGGGGCTGTTTGTTATGTAGG - Intergenic
1138804921 16:60080882-60080904 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1139225942 16:65233495-65233517 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1139230629 16:65278912-65278934 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1139943078 16:70620127-70620149 TTTGGAGTTTTATTTAATGTCGG + Intronic
1139943748 16:70624445-70624467 TTTGGAATTTTATTTAATGTCGG + Intronic
1140288280 16:73625686-73625708 TTGGGAGCTTGTTCAAATGCAGG + Intergenic
1140989534 16:80195354-80195376 TTTGGGGTTTCTTATAATGTAGG + Intergenic
1141852223 16:86654273-86654295 TTAGGAGCTTTTCCCTATGTGGG + Intergenic
1141865231 16:86745684-86745706 TTTGGACTTTTATTTAATGTCGG + Intergenic
1143414373 17:6735278-6735300 TTTGGAGCTTTATTTAATGTTGG + Intergenic
1143817651 17:9530971-9530993 TTTGGAATTATTTCTTATGTAGG + Intronic
1145080693 17:19892120-19892142 TTTGGAGCTTTTTCTAATGTCGG + Intergenic
1146597869 17:34185324-34185346 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1146968106 17:37049972-37049994 TTTGGAGCTTTGGCAAATGGAGG + Intronic
1149046173 17:52247984-52248006 CCTTGAGCTTTCTCTAATGTTGG - Intergenic
1150999750 17:70361096-70361118 TTTGCATCCTGTTCTAATGTGGG - Intergenic
1151439842 17:74121074-74121096 TTTGGATCTTCTTCTAAACTTGG - Intergenic
1151622460 17:75254597-75254619 TTTGGAGTTTTATTTAATGTCGG - Intronic
1151839783 17:76609614-76609636 TTTGGAGTTTTATTTAATATCGG + Intergenic
1153631180 18:7071536-7071558 TTTGGTGCTTTTTCTGTTATGGG - Intronic
1153895035 18:9551202-9551224 TATGTAGCTTTTTCTACTGTAGG - Intronic
1155662092 18:28261449-28261471 TTTTGAGCCTTTGCTCATGTGGG + Intergenic
1155697044 18:28696761-28696783 TTGGGAGTTTTATTTAATGTCGG + Intergenic
1155835167 18:30573030-30573052 TTTGGAGTTTTATGTAATCTTGG - Intergenic
1155883796 18:31183123-31183145 TTTTTAAATTTTTCTAATGTTGG + Intergenic
1155892713 18:31287910-31287932 TTTTGAGCTTTATTTAATGTTGG + Intergenic
1156096993 18:33545708-33545730 ATTGCAGCTTTTTCTACTTTAGG - Intergenic
1156237327 18:35217793-35217815 TTTGGAGCTTTATTTAATGTCGG - Intergenic
1156251960 18:35359994-35360016 TTTGGAGCTTTATTTAATGTCGG + Intergenic
1156608608 18:38699097-38699119 TTTGGAAAGTTTTCTAATGATGG + Intergenic
1156924084 18:42556171-42556193 TTTGGAGCTTTATTTCATGTCGG + Intergenic
1156958154 18:42992924-42992946 TTTGGAGCTTTATTTCATGTCGG - Intronic
1158359923 18:56660478-56660500 TTTGGATTTTTTTCAAATTTGGG - Intronic
1159164439 18:64683691-64683713 ATTGGAGTTTTATTTAATGTCGG - Intergenic
1159835024 18:73326687-73326709 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1160668264 19:343879-343901 TTTGAAGCTTTTTTTGATTTTGG - Intronic
1161123821 19:2544943-2544965 TTGGGAGCTTATTCTAGTGTGGG - Intronic
1161661689 19:5550521-5550543 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1162231756 19:9272379-9272401 TTTGGTGCTTTTTTTTTTGTAGG + Intergenic
1162262182 19:9542259-9542281 TTTGGAGCTTTTTCTAGTCTTGG - Intergenic
1163071594 19:14847138-14847160 TTTGGAGTTTTTGCCAATTTTGG - Intergenic
1163907155 19:20157583-20157605 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1164080777 19:21859808-21859830 TTTGGAGCTTTTTCTAATATTGG - Intergenic
1164202527 19:23030480-23030502 TTTGGAGTTTTATTTAATGTTGG + Intergenic
1164459258 19:28433549-28433571 TTTGAAGTTTTATTTAATGTCGG + Intergenic
1164585540 19:29470813-29470835 TTTTGTTCTTTTTCTATTGTTGG - Intergenic
1165249208 19:34516018-34516040 TTTGGAGTTTTATTTAATGTTGG - Intergenic
1165497032 19:36159065-36159087 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1165510345 19:36263144-36263166 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1165835328 19:38751639-38751661 TTTGGAGTTTTATTTAATGTCGG - Intronic
1166498969 19:43327162-43327184 TCTGGAGTTTTATTTAATGTCGG + Intergenic
1166905822 19:46107738-46107760 TTTGGAACTTTTTCTAATATCGG + Intergenic
1167902120 19:52629822-52629844 TTTGGAGTTTTATTTAATGTCGG - Intronic
1168051613 19:53833659-53833681 TTTGGAGTTTTATTTCATGTCGG - Intergenic
1168212148 19:54898582-54898604 TTTGGAGCTTTATTTAATGTTGG + Intergenic
1168228015 19:55010437-55010459 TTTGGAGTTTTATTTAATGTCGG + Intergenic
925504792 2:4549891-4549913 TTTTGAGTCTTTTCTCATGTTGG - Intergenic
925828847 2:7876321-7876343 TTTGGAGTTTTATTTAATGTCGG + Intergenic
926096111 2:10081176-10081198 TTTGGAGTGTTTTCTAGTCTGGG - Intergenic
926413562 2:12628552-12628574 TTTGGAGTTTTATTTAATGTCGG - Intergenic
926464120 2:13167650-13167672 TTTGGAGTTTTATTTCATGTCGG + Intergenic
926815576 2:16795600-16795622 TTTGGAGTTTTATTTAATGTTGG + Intergenic
927134141 2:20084366-20084388 TTTGGAGCTTTATTTAATGTTGG - Intergenic
928770148 2:34695873-34695895 TTTCTAGCTTTATTTAATGTTGG - Intergenic
928778279 2:34791758-34791780 TTTGGAGCTTTATTTAAAGTCGG - Intergenic
928827685 2:35440779-35440801 TTTGGAGTTTTATTTAATGTCGG + Intergenic
928857139 2:35815107-35815129 TTTGGAGTTTTATTTAATGTTGG - Intergenic
928928534 2:36601086-36601108 TTTGGAGTTTTATTTAATGTTGG - Intronic
929004860 2:37384656-37384678 TTTGGAGATTTATTTAATGTCGG + Intergenic
929076700 2:38084425-38084447 TTTGGAGTTTTATTTAATGTCGG + Intronic
929684557 2:44022719-44022741 TTTAGAGCTTTTTCTAATGCTGG + Intergenic
930815168 2:55589396-55589418 TTTGTAACTTTATCTACTGTCGG - Intronic
930955070 2:57195017-57195039 TTTGGAGTTTTATTTAATGTCGG - Intergenic
930958351 2:57230912-57230934 TTTGGAGCTTTATTTAATGTCGG - Intergenic
931026420 2:58117072-58117094 TTTGGAGTTTTATTTAATGTCGG + Intronic
931236914 2:60419673-60419695 TTTGGAGTTTTATTTAATGTCGG - Intergenic
931850397 2:66245979-66246001 TTTGGAGTTTTATTTAATGTCGG - Intergenic
932295826 2:70622678-70622700 TTTGGAGTTTTATTTAATGTCGG - Intronic
932491310 2:72123977-72123999 TTTGCATCTTTTTCTAAAGTTGG - Intergenic
932854237 2:75217452-75217474 TTTGGAGTTTTATTTAATGTCGG + Intergenic
932973980 2:76577513-76577535 TTTGGAGTTTTATTTAATGTTGG + Intergenic
933013062 2:77090427-77090449 TTTGGAGTTTTATTTAATGTCGG - Intronic
933079244 2:77967160-77967182 TTTGGAGTTTTATTTAATGTCGG - Intergenic
933116803 2:78484019-78484041 TTTGCAGCATTTGCTAATGTAGG - Intergenic
933329547 2:80878126-80878148 TTTGGAGTTTTATTTAATGTCGG + Intergenic
933552422 2:83792569-83792591 TTTGGAGTTTTATTTAATGTCGG + Intergenic
935761883 2:106328313-106328335 TTTGGAGCATTTTGGATTGTTGG - Intergenic
936794321 2:116187924-116187946 TTTGGAGCTTTATTTAAAGTCGG + Intergenic
936883306 2:117280792-117280814 TTTGGAGTTTTATTTAATGTCGG - Intergenic
937445231 2:121952003-121952025 GCTGCAGCTTTTTCAAATGTTGG + Intergenic
938820570 2:134954350-134954372 TTTGGAACTTTTGCTCATTTTGG - Exonic
939010819 2:136844077-136844099 TTTTGATCTTTTTCAGATGTTGG + Intronic
939307380 2:140428163-140428185 TTTGGAGTTTTATTTAATGTTGG - Intronic
939777082 2:146401776-146401798 TTTGAAGGCTTTTCTCATGTGGG + Intergenic
939779869 2:146432658-146432680 TTTGGAGCTTTTGTTCAGGTGGG + Intergenic
939824859 2:147001778-147001800 TTAGGTGATTTTTTTAATGTAGG - Intergenic
939861866 2:147430349-147430371 TTTGTAGCGATTTCTAATCTAGG + Intergenic
940182914 2:150955090-150955112 TTTGGAGCTTTTTTTAATGTCGG - Intergenic
940216789 2:151310862-151310884 TTGGGAGCTTTAGTTAATGTCGG - Intergenic
940439076 2:153692984-153693006 TTTGAGCCTTTTTTTAATGTTGG - Intergenic
940530163 2:154869372-154869394 TTTGGAGTTTCATTTAATGTCGG - Intergenic
940675832 2:156723728-156723750 TTTGGAGTTTTATTTAATGTCGG + Intergenic
940726467 2:157341793-157341815 TTTGGAGTTTTTTCTAACGTTGG + Intergenic
940889182 2:159018154-159018176 TTTGGAGCATTTTATTATGAAGG + Intronic
941456212 2:165714155-165714177 TTTGGAGTTTTATTTAATGTCGG + Intergenic
941540767 2:166781686-166781708 TTTGGAGCTTTGATTAATTTGGG - Intergenic
942097055 2:172543763-172543785 TTTGGAGTTTTATTTAATGTCGG - Intergenic
942473425 2:176287376-176287398 TTTGGAGCATTTTCAGATTTTGG - Intronic
942479104 2:176363369-176363391 TTTGGACTTTTTTCTAATTGTGG - Intergenic
942516036 2:176754220-176754242 TTTGGAGCTATTTCTCAAGAAGG - Intergenic
942730322 2:179055435-179055457 TTTGGAGTTTTATTTAATGTCGG + Intergenic
943412958 2:187564138-187564160 TTTGGAGTTTTATTTAATGTCGG + Intronic
943461223 2:188172890-188172912 TTTGGAGTTTTATTTAATGTCGG + Intergenic
943638088 2:190327792-190327814 TTTGGTGCTTTGTCTAATCATGG + Intronic
943673211 2:190687582-190687604 TTTTGAGCTTTTTCAGATTTTGG - Intronic
943951321 2:194134569-194134591 TTTGGAGCTTTATTTAATGTCGG + Intergenic
944387423 2:199181423-199181445 TTTGGAGTTTTATTTAATGTCGG - Intergenic
944394110 2:199248976-199248998 TTTGGAGTTTTATTTAATGTCGG - Intergenic
945153130 2:206810516-206810538 TTTGGAGTTTTATTTAATGTTGG + Intergenic
945173424 2:207019266-207019288 TTTGGAGTTTTATTTAATGTTGG - Intergenic
945301513 2:208219922-208219944 TTTGGAGATTTATTTAACGTTGG + Intergenic
945361616 2:208901266-208901288 TTTGGAGTTTTATTTAATGTGGG - Intergenic
945394275 2:209301275-209301297 TTTGGAGTTTTATTTAATGTCGG - Intergenic
945938288 2:215924422-215924444 TTTGGAGTTTTATTTAATGTCGG - Intergenic
945972379 2:216243318-216243340 TTTGGTGTGTTTTCTAATGCAGG + Intergenic
946723239 2:222633737-222633759 TTTAGAGCTTTCTTTAATTTGGG - Intronic
946781074 2:223193527-223193549 TTTGGAATTTTATTTAATGTCGG + Intronic
946871788 2:224091536-224091558 TTTGGAGTTTTATTTAATGTCGG + Intergenic
946886471 2:224227341-224227363 TTTGGAGTTTTATTTAATGTCGG - Intergenic
946893246 2:224298726-224298748 TTTGGAGTTTTATTTAATGTCGG - Intergenic
947273040 2:228360305-228360327 TCTGGATATTTTTCAAATGTTGG + Intergenic
948390656 2:237609006-237609028 TTTGGAGTTTTATTTAATGTTGG - Intergenic
948537506 2:238657137-238657159 TTTGGAGCCTTTTTTAATGTAGG - Intergenic
1168739317 20:174543-174565 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1168839238 20:898569-898591 TTTGGAGCTTTTTCTAATGTTGG - Intronic
1169484988 20:6022137-6022159 TTTGGAATTATTTTTAATGTAGG + Intronic
1169933158 20:10855566-10855588 TTTTGAACTTTTTAGAATGTTGG - Intergenic
1170106207 20:12755923-12755945 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1170325517 20:15151520-15151542 TTTGGAGTTTTATTTAATGTCGG + Intronic
1170820729 20:19754805-19754827 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1173101883 20:40095392-40095414 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1173118845 20:40271108-40271130 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1173763807 20:45587883-45587905 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1174126808 20:48312498-48312520 TAGGAAGCTTTTTCTAATGGAGG + Intergenic
1174437749 20:50523116-50523138 TTTGGTGATTTATCGAATGTGGG + Intronic
1174735034 20:52957903-52957925 CTTAGTGCTTTTTCTAATGAGGG - Intergenic
1177031204 21:15983476-15983498 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1177840774 21:26231726-26231748 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1178050903 21:28746217-28746239 TTTGGAGCTTTTTCTGTGGCAGG + Intergenic
1178172137 21:30053237-30053259 TTTGGAGGTTTTTCAAATGAAGG - Intergenic
1178452730 21:32718859-32718881 TTGGTAGCATTTTCTAATGAGGG - Intronic
1178956137 21:37023700-37023722 TGTTGAGCTTTTTTTCATGTTGG + Intergenic
1179015313 21:37590697-37590719 TTTGGAGCTTTATTTAAAGTCGG + Intergenic
1179387527 21:40957001-40957023 TCTGGAGTTTTATTTAATGTCGG - Intergenic
1179421156 21:41238027-41238049 TTAGGAGTTTTTACTAAGGTGGG + Intronic
1180860639 22:19079291-19079313 TTTGGATTTTTTTCTGATTTTGG - Intronic
1182732248 22:32504840-32504862 TTTGGAGTTTTATTTAATGTTGG - Intergenic
1182998579 22:34836365-34836387 TTTGGAGCTTTATATAAAGTTGG - Intergenic
1184106415 22:42369744-42369766 TTTAGAGCTATCTTTAATGTTGG + Intergenic
949162125 3:894328-894350 TTTGGAGTTTTATTTAATGTCGG + Intergenic
949190425 3:1243471-1243493 TTTGGAGTTTTATTTAATGTCGG + Intronic
949287354 3:2422338-2422360 TTTAGAGCTTTTTATAAAATGGG + Intronic
949671123 3:6399704-6399726 TTTGGAGTTTTATTTAATGTCGG - Intergenic
949817574 3:8075924-8075946 TTTTGAGCTTTCTCTTTTGTAGG + Intergenic
949827413 3:8179067-8179089 TTTGGAGTTTTATTTAATGTAGG - Intergenic
951193285 3:19795467-19795489 ATTGGAGCTTCTTCATATGTGGG - Intergenic
951298840 3:20971171-20971193 TTTGGAGTTTTATTTAATGTCGG + Intergenic
951316348 3:21192885-21192907 TTTGGAGTTTTATTTAATGTCGG + Intergenic
951332354 3:21382217-21382239 TTTGGAGTTTCATTTAATGTCGG + Intergenic
951762826 3:26164055-26164077 TTTGGAGTTTTATTTAATGTCGG + Intergenic
951889009 3:27551813-27551835 TTTGGAGGTTTATTTAATGTTGG + Intergenic
952216899 3:31287308-31287330 TTTGGAGTTTTTTTTATTATAGG - Intergenic
952343589 3:32465096-32465118 TTTGGAGCTTTATTTAATGTTGG + Intronic
952798406 3:37264191-37264213 TTTGAATTATTTTCTAATGTGGG + Intronic
953039361 3:39241320-39241342 TTAAGAGATTTTTCTAAAGTGGG + Intergenic
953177167 3:40563042-40563064 TTTGGAGTTTTATTTAATGTCGG - Intronic
953599467 3:44348682-44348704 TTTGGAGCTTTTTCTAATGTCGG + Intronic
953825732 3:46249953-46249975 TTTGGAGTTTTATTTAATGTCGG + Intronic
953877170 3:46673039-46673061 TTTTGAGGTTGTTCTAGTGTTGG + Intronic
954969294 3:54638142-54638164 TTTGGAGTTTTATTTAATGTCGG + Intronic
956174936 3:66464101-66464123 TTAAGTCCTTTTTCTAATGTGGG - Intronic
956233527 3:67042366-67042388 TTTGGAGCTTTATTTAATGTCGG + Intergenic
956492002 3:69782648-69782670 TTTGAAGCTTGTTTTATTGTAGG + Intronic
956495991 3:69826476-69826498 TTTGGAGCCTTTTCTAATTTGGG + Intronic
956709188 3:72025012-72025034 TTTGGAGTTTTATTTAATGTCGG - Intergenic
957317341 3:78586806-78586828 TTTGGAGTTTTATTTAATGTTGG + Intergenic
957451414 3:80386929-80386951 TTTGGAACTTTATTTAATGTTGG - Intergenic
957515129 3:81240427-81240449 ATAGCAGCATTTTCTAATGTTGG - Intergenic
957734890 3:84191488-84191510 TTTGGAGCTTTATTTAATGTTGG + Intergenic
957904877 3:86542108-86542130 TTTGGAGTTTTATTTAATGTCGG + Intergenic
957985664 3:87571401-87571423 TTTGGAGCTTTATTTAATATCGG - Intergenic
957997785 3:87712110-87712132 TTTGGACCTTTTTCACATGGTGG + Intergenic
958421925 3:93939823-93939845 TTTGGAGCTTTTTCTAATGTCGG - Intronic
959485799 3:106926389-106926411 TTTGGAGTTTTATTTAATGTCGG + Intergenic
959543726 3:107570328-107570350 TTTGGAGCTTTTTCTAATGTCGG + Intronic
960282906 3:115797165-115797187 TTTGGAGTTTCATTTAATGTCGG + Intergenic
960310145 3:116108978-116109000 TTTGGAGTTTTATTTAATGTCGG + Intronic
960417561 3:117403297-117403319 TTTGGAGCTTTTACTATTCCCGG - Intergenic
961094299 3:124141411-124141433 TTTTCTGCTTTTTCTCATGTGGG + Intronic
961164791 3:124756212-124756234 TTTGGAGTTTTATTTAATGTTGG + Intergenic
961730556 3:128961756-128961778 TTTGGAGTTTTATTTAATGTCGG - Intronic
961881022 3:130061323-130061345 TTTGGAGTTTTATTTAATGTCGG - Intergenic
961893743 3:130150826-130150848 TTTGGAGTTCTATTTAATGTCGG + Intergenic
961951385 3:130753008-130753030 TTTGTAGCTGTTTCTAATCCTGG - Intergenic
962092200 3:132256190-132256212 TTTGGATCTTTACCTACTGTGGG - Intronic
962660599 3:137597497-137597519 TTTGGAGTTTTATTTAATGTTGG - Intergenic
963058588 3:141206989-141207011 TTTGGAGTTTTATTTAATTTTGG - Intergenic
963663312 3:148153701-148153723 TTTGGAGTTTTATTTAATGTCGG - Intergenic
963684303 3:148416398-148416420 TTTGGAGTTTTATTTAATGTCGG - Intergenic
964300288 3:155278868-155278890 TTTGGAGCTTTATTTAATGTCGG + Intergenic
964425079 3:156544036-156544058 TTTGGAGCTTTTTTTTAAGGAGG + Intronic
964577316 3:158187167-158187189 TTTGGATATTTTTCTCCTGTTGG - Intronic
964837298 3:160953585-160953607 TTGTGATCTTTTTCTAATGGCGG + Intronic
964904121 3:161696961-161696983 TTAGGATCTTTTTCTTCTGTTGG + Intergenic
964984900 3:162726205-162726227 TTTGGAGTTTTATTTAATGTCGG + Intergenic
965262684 3:166504472-166504494 TTTGGAGTTTTATTTAATATCGG + Intergenic
965336297 3:167433238-167433260 TTTGGAGTTTTATTTAATGTCGG - Intergenic
965862003 3:173159595-173159617 TTTGGAGCTTTATTTAATGTTGG + Intergenic
966085401 3:176063358-176063380 TTTCGAGTTTTATTTAATGTTGG - Intergenic
966105114 3:176325284-176325306 TTTGGAGTTTTATTTAATGTCGG + Intergenic
966136429 3:176704447-176704469 TCTAGAGCTTTTTCTACTCTTGG - Intergenic
966229630 3:177637719-177637741 TTTGGATCTTTTTCTCTTCTTGG + Intergenic
966232878 3:177669499-177669521 TTTGGAGTTTTATTTAATGTTGG + Intergenic
966279270 3:178209555-178209577 TTTGGAGTTTTATTTAATGTCGG - Intergenic
966397620 3:179518885-179518907 TTTGGAGCTTTATTTAATGTTGG - Intergenic
967005395 3:185378210-185378232 TTTGGAGCTTTATTTAATATCGG + Intronic
967212197 3:187179189-187179211 TTTGGAGTTTTATTTAATGTCGG + Intronic
967244198 3:187469931-187469953 TTTGGAGTTTTATTTAATGTCGG + Intergenic
967252749 3:187559836-187559858 TTTGGACATTTTTCTTATCTGGG + Intergenic
967496194 3:190146555-190146577 TTTGGAGTTTTATTTAATGTTGG - Intergenic
967658137 3:192074745-192074767 TTTGGAGTTTTATTTAATGTCGG + Intergenic
968993356 4:3929427-3929449 TTTGGAGTTTTATTTAATGTAGG - Intergenic
969003841 4:4003903-4003925 TTCAGAGCTTTATTTAATGTCGG + Intergenic
969749025 4:9096282-9096304 TTTGGAGTTTTATTTAATGTCGG - Intergenic
969810087 4:9640922-9640944 TTCAGAGCTTTATTTAATGTCGG - Intergenic
969943386 4:10757948-10757970 TTTGGAATTTTTTATCATGTGGG + Intergenic
970087515 4:12365789-12365811 TTTGGAGTTTTATTTAATTTTGG - Intergenic
970256448 4:14174185-14174207 TTTGGAGTTTTATTTAATGTCGG + Intergenic
970532704 4:16999714-16999736 TTTGGAGTTTTATTTAAAGTTGG - Intergenic
970854077 4:20633959-20633981 TTTGGAGCTTTATTTAAAGTCGG + Intergenic
971180531 4:24325260-24325282 TTTGGAGTTTTATTTAATGTCGG - Intergenic
971200111 4:24503058-24503080 TTTGGAGTTTTATTTAATGTCGG - Intergenic
972071166 4:35020473-35020495 TTTGGAGCTTTTTCTAAAGTCGG + Intergenic
973751094 4:54021828-54021850 TCTGGAGCTTTTTTTAATGTTGG - Intronic
974173458 4:58295008-58295030 TTTGGAACTTTATTTAATGTTGG + Intergenic
974336569 4:60554456-60554478 TTTGAAGGTTTGTCTAAAGTAGG - Intergenic
974428425 4:61767952-61767974 TTTGGAGTTTTATTTAATGTCGG + Intronic
974903753 4:68032667-68032689 TTTGGAGCTTTATTTAATGTTGG - Intergenic
974961770 4:68711078-68711100 TTTGGAAATTCTTCCAATGTAGG + Intergenic
975865118 4:78717522-78717544 TTTGGAGTTTTATTTAATGTTGG + Intergenic
975933918 4:79557640-79557662 TTTGGAGTTTTATTTAATGTTGG + Intergenic
976696506 4:87923915-87923937 TTTGGAGTTTTATTTAATGTTGG - Intergenic
976722584 4:88184011-88184033 TTTGGAGGTTTTTATCATGAAGG - Intronic
976817772 4:89170082-89170104 TTTGGAGCATGTTCAAATGTAGG - Intergenic
976884600 4:89968456-89968478 TTTGGAGTTTTATTTAATGTTGG + Intergenic
977012954 4:91658286-91658308 TTTGGAGTTTTATTTAATGTTGG + Intergenic
977062537 4:92275155-92275177 TTTGGAGTTTTATTTAATGTTGG + Intergenic
977075237 4:92442625-92442647 GTTGGAGTTTTATTTAATGTTGG + Intronic
977198459 4:94088288-94088310 TTTGGAGTTTTATTTAATGTCGG + Intergenic
977217184 4:94296879-94296901 TTTGGAGTTTTATTTAATGTCGG + Intergenic
977225372 4:94387132-94387154 TTTGGAGTTTTATTTAATGTTGG + Intergenic
977782471 4:100995470-100995492 TTTGGAGTTTTATTTAGTGTTGG + Intergenic
977902826 4:102442265-102442287 GTTGCTGATTTTTCTAATGTAGG - Intergenic
977910383 4:102527902-102527924 TTTGAAAGTTTTTCTTATGTGGG + Intronic
978031450 4:103943161-103943183 TTTGGAGTTTTATTTAATGTTGG - Intergenic
978303255 4:107294106-107294128 TTTAGAGCTTTTTCTAATGTCGG + Intergenic
978438582 4:108711074-108711096 TTTGGAGTTTTATTTAATGTCGG - Intergenic
978704964 4:111697079-111697101 TTTGCACATTTTTTTAATGTTGG - Intergenic
979054650 4:115979317-115979339 TTTGGAGTTTTATTTAATGTCGG + Intergenic
979146590 4:117254147-117254169 TTTGGAGTTTTATTTAATGTCGG - Intergenic
979244438 4:118483660-118483682 TTTGCAGCTTTTTAAAATATAGG + Intergenic
979655887 4:123193268-123193290 TCTGGAGCATTTTTTAAAGTTGG - Intronic
979850336 4:125565300-125565322 TTTGGAGTTTTATTTAATGTCGG + Intergenic
979895190 4:126148802-126148824 TTTGGAGTTTTATTTAATGTCGG + Intergenic
980006267 4:127545394-127545416 TTTTAAAGTTTTTCTAATGTAGG - Intergenic
980111959 4:128644499-128644521 TTTGGAGTTTTATTTAATGTTGG + Intergenic
980284917 4:130769380-130769402 TTTGGAGTTTTATTTAATGTTGG - Intergenic
980296641 4:130927059-130927081 TTTGGAGATTTTTAAAATATTGG - Intergenic
980472471 4:133267383-133267405 TTTGGAGTTTTATTTAATGTCGG + Intergenic
980527838 4:134014191-134014213 TTTGGAGTTTTATTTAATGTCGG - Intergenic
980575666 4:134681570-134681592 TTTGGAGTTTTATTTAATGTCGG + Intergenic
981019644 4:140011936-140011958 TTTGGAACTTTTAATAATTTAGG - Intronic
981040215 4:140215541-140215563 TTTGGAGTTTTATTTAATGTTGG - Intergenic
981082521 4:140649444-140649466 TTTGGAGTTTTTTCTGATCAAGG - Intronic
981482754 4:145255209-145255231 TTTGGAGCTTTTTCTAATGTCGG + Intergenic
981539693 4:145834792-145834814 TTTGGAGTTTTATTTAATGTCGG - Intronic
982414227 4:155112125-155112147 TTTGGAGTTTTATTTAATGTTGG + Intergenic
982497136 4:156107130-156107152 TTTGGAGTTTTATTTAATGTCGG + Intergenic
982535416 4:156602329-156602351 TTTGGAGTTTTATTTAATGTCGG - Intergenic
982714250 4:158790249-158790271 TTTGGAGTTTTTTCAGATTTTGG + Intronic
983023842 4:162711149-162711171 TTTGGAGTTTTATTTAATGTTGG - Intergenic
983055456 4:163095135-163095157 TTTGGAGTTTTATTTAATGTCGG - Intergenic
983264786 4:165496838-165496860 CTTGAATCTTTTCCTAATGTGGG - Intronic
983345526 4:166522542-166522564 TTTGGAGTTTTATTTAATGTTGG - Intergenic
983414740 4:167439468-167439490 TTTGGAGTTTTATTTAATGTCGG + Intergenic
983452309 4:167924941-167924963 TTTGGAGTTTTATTTAATGTTGG - Intergenic
983659544 4:170118502-170118524 TTTGAAGTTTTATGTAATGTCGG - Intergenic
984128903 4:175848425-175848447 GTTGGATATTTTTCAAATGTAGG - Intronic
984165388 4:176298538-176298560 TTTGGAGTTTTATTTAATGTCGG + Intergenic
984411695 4:179405238-179405260 TTTGGAGCTTTTTCTAATGTTGG - Intergenic
984437230 4:179722466-179722488 TTTGGAGTTTTATTTAATGTTGG - Intergenic
984477404 4:180254566-180254588 TTGAAAGCTTCTTCTAATGTAGG + Intergenic
985318881 4:188687101-188687123 TTTTGTGCTTTTTCGTATGTCGG + Intergenic
985389899 4:189483127-189483149 TTTGGAGTTTTATTTAATGTCGG + Intergenic
985435691 4:189927869-189927891 TTAGGAGTTTTATTTAATGTCGG - Intergenic
985582328 5:704837-704859 TTTGGAGTTTTATTTAATGTTGG - Intergenic
986159032 5:5207229-5207251 TTTGTAGATTTTTCTCATGTAGG + Intronic
986388848 5:7265632-7265654 TTTGGAGTTTTATTTAATGTCGG - Intergenic
986502605 5:8416116-8416138 TTTGGAGCTTTTTGTAATGTTGG - Intergenic
986905744 5:12491849-12491871 TTTGGAGTTTTATTTAATGTCGG - Intergenic
986919617 5:12666203-12666225 TTTGGAGTTTTATTTAATGTCGG + Intergenic
987282012 5:16422061-16422083 TTTGGAGTTTTATTTAATGTCGG - Intergenic
987487474 5:18540355-18540377 TTTGGAGTTTTATTTAATGTCGG - Intergenic
987498154 5:18672522-18672544 TTTGGAGTTTTATTTAATGTTGG + Intergenic
987755800 5:22096869-22096891 TTTGGAGCTTTATTTAATGTTGG - Intronic
988199065 5:28047660-28047682 TTTGGAGCTTTTTCTAATGTCGG - Intergenic
989074031 5:37543637-37543659 TTTGGAGCATTTCTTAATATTGG + Intronic
989659898 5:43788162-43788184 TTTGGAGCTTTTTCTAATGTTGG - Intergenic
989688927 5:44118398-44118420 TTTGGAGCTTTTTGTAATGTCGG + Intergenic
990565151 5:57020671-57020693 TTTGGAGCTTTTTTTAATGTCGG + Intergenic
990791839 5:59489702-59489724 TTTTGAGTTCTTTTTAATGTGGG - Intronic
991349173 5:65702820-65702842 GTTGGATATTTTTCAAATGTTGG - Intronic
991399558 5:66238816-66238838 TATCGAGCTTTTTCCAAAGTTGG + Intergenic
992394632 5:76359399-76359421 TTTGGAGTTTTATTTAATGTCGG - Intergenic
992452035 5:76884071-76884093 TTTGGAGCTTTATTTAATGTTGG + Intronic
993192685 5:84700526-84700548 TTTGGAGTTTTATTTAATGTCGG - Intergenic
993836676 5:92826022-92826044 TTTGGAGTTTTATTTAATGTCGG - Intergenic
994126138 5:96170563-96170585 TTTGGAGCTTTATTTAATGTCGG + Intergenic
994295115 5:98081085-98081107 TTTGGAGTTTTATTTAATGTCGG - Intergenic
994375818 5:99014998-99015020 TTTGGAGCTTTTTCTAATGTCGG + Intergenic
994532572 5:100987917-100987939 TTTGGAGTTTTATTTAATGTCGG + Intergenic
994556901 5:101316957-101316979 TTTGGAGTTTTATTTAATGTCGG - Intergenic
994737987 5:103580940-103580962 TTTTCAGCTTTTTTTATTGTTGG + Intergenic
994775656 5:104033664-104033686 TTTGGAGTTTTATTTAATGTCGG - Intergenic
994989517 5:106980427-106980449 TTTGGAGTTTTATTTAATGTCGG - Intergenic
995296650 5:110531888-110531910 TTTGGAGTTTTATTTAATGTTGG - Intronic
995356880 5:111248361-111248383 TTTGGAGATTTTCTTACTGTGGG + Intronic
995369653 5:111404896-111404918 TTTGGGGGTTTTGTTAATGTTGG + Intronic
995769350 5:115652548-115652570 TTTGGAGCTTTTTCTAATGTCGG - Intergenic
995899396 5:117050029-117050051 TTTGTAGTTTTATTTAATGTCGG + Intergenic
996203288 5:120701254-120701276 TTTGGAGTTTTATTTAATGTCGG + Intergenic
996265763 5:121537701-121537723 TTTTGACCTTTTTTCAATGTAGG - Intergenic
996344853 5:122477268-122477290 TTTGGAGTTTTATTTAATGTCGG + Intergenic
996358657 5:122622557-122622579 TTTGGAGCTTTATTTAATGTTGG + Intergenic
996509874 5:124305822-124305844 TTTGGAGCTTTATTTAATGTTGG - Intergenic
996528025 5:124499075-124499097 TTTGGAGTTTTATTTAATGTCGG - Intergenic
996575033 5:124970286-124970308 TTTGGAGCTTTATTTAATGTTGG + Intergenic
996745476 5:126843222-126843244 TTTGGAGTTTTATTTAATGTCGG + Intergenic
997151389 5:131499666-131499688 TTTGTAGCTTTTTCAAAGGTTGG + Intronic
998693734 5:144615028-144615050 TTTGGAGAATTATTTAATGTCGG + Intergenic
998995359 5:147865322-147865344 TTTGGAGTTTTATTTAATGTCGG - Intergenic
998996427 5:147872636-147872658 TTTGGAGTTTTATTTAATGTCGG + Intronic
1000233066 5:159333162-159333184 TTGGCAGGTTGTTCTAATGTGGG + Intergenic
1000519439 5:162279040-162279062 TTTGGAGTTTTATTTAATGTAGG + Intergenic
1000935675 5:167301578-167301600 TTTGGAGTTTTATTTAATGTTGG + Intronic
1001331481 5:170765697-170765719 TTTGGAGTTTTATTTAATGTAGG + Intronic
1002063983 5:176643154-176643176 TTTGGAGACTTTTCTCCTGTGGG - Exonic
1002610994 5:180418389-180418411 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1002618765 5:180471488-180471510 TTTCGAGCTTTTCCTCACGTGGG - Intergenic
1002761654 6:207072-207094 TTTGGAGCATTTTGTATTTTTGG - Intergenic
1003430198 6:6031446-6031468 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1004106235 6:12669424-12669446 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1004283553 6:14300614-14300636 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1004508026 6:16262656-16262678 TTTGGAGTTTTCTTTAATGTCGG + Intronic
1004768606 6:18757729-18757751 TTTGGAGTTTTATTTAATGTTGG + Intergenic
1004827703 6:19441537-19441559 TTTGGATTTTTTTTTAATTTTGG + Intergenic
1004836968 6:19540924-19540946 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1005014688 6:21365171-21365193 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1005121707 6:22397075-22397097 TCTGGTGCTTTTTCTAAGGGGGG + Intergenic
1005786608 6:29250896-29250918 TTTGGAGCTTTTTCTAATGTTGG + Intergenic
1005915869 6:30351114-30351136 TTTGGAGCTTGTTCTAACCCTGG + Intergenic
1006795405 6:36729091-36729113 TCTGAAGCTATTTCTTATGTAGG - Intronic
1007028387 6:38602062-38602084 TATGGATCTTTTTATAATATTGG - Intronic
1007090980 6:39184854-39184876 TTTAGAGCTGTTTCAACTGTGGG - Intergenic
1008416105 6:51242487-51242509 TTTTGAGGCTTTTCTAATTTAGG - Intergenic
1008850246 6:56014478-56014500 TTTGGAGCTTTATTTAAAGTCGG + Intergenic
1009269788 6:61602122-61602144 TTTGGAGCTTTGTTTAATATTGG - Intergenic
1009270658 6:61609442-61609464 TATGTAGCTATTTATAATGTTGG + Intergenic
1009456528 6:63863334-63863356 CTTGCAGCTTTTTGTAATTTAGG + Intronic
1009464310 6:63951953-63951975 TTTGGAGCTTTATTTAATGTCGG - Intronic
1009750329 6:67872629-67872651 TTTGGAGATTTATTTAATGTCGG + Intergenic
1010099322 6:72084887-72084909 TTTGTATATTTTTCTATTGTTGG - Intronic
1010586727 6:77664219-77664241 TTTGGAGTTTTATTTAATGTTGG + Intergenic
1010826942 6:80486101-80486123 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1010894574 6:81348801-81348823 TTTGGAGTTTTATTTAATTTCGG + Intergenic
1011367925 6:86602027-86602049 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1011770974 6:90673876-90673898 TTTGGAGTTTTATTTAATGTTGG + Intergenic
1011929644 6:92694800-92694822 TTTGGGGCTTGCTCTAATTTGGG - Intergenic
1012014421 6:93833742-93833764 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1012066575 6:94557610-94557632 TTTGGAGTTTTATTTAATGTTGG + Intergenic
1012231640 6:96767161-96767183 TTAGGAGCTTTTTATATAGTAGG + Intergenic
1012315793 6:97781643-97781665 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1012675072 6:102104005-102104027 TTTGGAGTTTTATTTAAAGTTGG - Intergenic
1012689546 6:102294972-102294994 TTTGGAGTTTTATTTAATGTTGG - Intergenic
1013018975 6:106191303-106191325 ATGGCAGCTTTTGCTAATGTGGG + Intronic
1013407915 6:109859416-109859438 TTTGGAGTTTTATTTAATGTAGG + Intergenic
1013808115 6:114016003-114016025 CTTGGAGCTTTTTCTAATGTTGG + Intergenic
1013843710 6:114425988-114426010 TTTGGAGTTTTATTTAATGTTGG + Intergenic
1013891674 6:115033931-115033953 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1014115376 6:117663374-117663396 TTTGGAGCTTTTTCTAACGTTGG + Intergenic
1014360191 6:120465930-120465952 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1014396037 6:120927236-120927258 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1014454901 6:121624103-121624125 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1014612052 6:123558662-123558684 TTTGGAGTCTTATTTAATGTCGG - Intronic
1014614704 6:123585952-123585974 TTTGGAGTTTTATTTAATGTCGG + Intronic
1014718865 6:124894083-124894105 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1014891514 6:126850799-126850821 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1014976746 6:127895044-127895066 TTTAAAGATTTTTCAAATGTTGG - Intronic
1015271344 6:131340921-131340943 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1015288066 6:131507945-131507967 TTTGGAGTTTTATTTAATGTTGG + Intergenic
1015673248 6:135715853-135715875 TTTGCAGCTTTTTCTTTTGTAGG - Intergenic
1016114171 6:140261074-140261096 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1016248833 6:142017854-142017876 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1016518773 6:144925218-144925240 TTTGGAGTTTTATTTAATGTTGG - Intergenic
1016535787 6:145106813-145106835 TTTGGACTTTTATTTAATGTCGG + Intergenic
1017269785 6:152492233-152492255 TTTGGAGCTTTTTCTAATGTTGG - Intronic
1017389468 6:153923531-153923553 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1017686683 6:156920606-156920628 TTTTTAGCATTTGCTAATGTGGG + Intronic
1018084528 6:160290235-160290257 TTTGGAGTTTTATTTAGTGTCGG + Intergenic
1018495432 6:164342394-164342416 TTTGGAGTTTTATTTAATGTTGG + Intergenic
1018521502 6:164655815-164655837 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1019382815 7:734287-734309 TTTGAAGATTTTTATCATGTAGG + Intronic
1020316022 7:6905836-6905858 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1020323975 7:6960358-6960380 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1020532745 7:9357083-9357105 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1020541172 7:9462219-9462241 TTTGGAGCTTTATTTAAAGTCGG + Intergenic
1020584352 7:10047393-10047415 TTTCAAGCTTTTTATACTGTGGG + Intergenic
1021429816 7:20547495-20547517 TTTGGAGTTTTATTTAAAGTCGG - Intergenic
1021637286 7:22705290-22705312 TTTGGAGATTTATTTAAAGTCGG - Intergenic
1021660598 7:22915165-22915187 TTTGGACCTTTTTGCAATGCTGG - Intergenic
1021675138 7:23072867-23072889 CCTGGAGCTTTCTCTAATGCAGG + Intergenic
1021810633 7:24398323-24398345 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1021977925 7:26027850-26027872 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1022372843 7:29786893-29786915 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1022447376 7:30481251-30481273 TTTGGAGCTTTATGTAACGTCGG - Intergenic
1022647446 7:32244506-32244528 TTTGGATCTTTTTCCTTTGTGGG + Intronic
1022709038 7:32834413-32834435 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1022710076 7:32841567-32841589 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1023289980 7:38658604-38658626 TTGGGTGCTTTTTCTATTTTGGG - Intergenic
1023698917 7:42874271-42874293 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1024697592 7:51872064-51872086 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1024764632 7:52642862-52642884 TTTGTGGCTTTTTCCAATGTAGG + Intergenic
1024906992 7:54394437-54394459 TTCCAAGCTTTTTTTAATGTTGG - Intergenic
1027157853 7:75781172-75781194 TTTGGAGTTTTATTTAATGTCGG - Intronic
1027354391 7:77341718-77341740 TTTGGAGCTTTATTTAATGTCGG - Intronic
1027536944 7:79415152-79415174 TTCATAGCTTTTTCTTATGTAGG - Intronic
1027616963 7:80435182-80435204 TTTGCATTTTTTTTTAATGTGGG + Intronic
1027677871 7:81181626-81181648 TTTGGAATTTTTGTTAATGTTGG + Intronic
1027851914 7:83461714-83461736 TTTGGAGTTTTATTTAATGTCGG - Intronic
1028589939 7:92483476-92483498 TTTGGAGCTTTATTTAATGTTGG + Intergenic
1028690148 7:93641907-93641929 TTTGGAGTTTCATTTAATGTCGG - Intronic
1029789933 7:102831699-102831721 TTTCCAGCTTTCTCTACTGTTGG + Intronic
1030163641 7:106532091-106532113 TTTGGAGCTTTTTCTAATGCCGG + Intergenic
1030445803 7:109645778-109645800 TTTGGAGCTTTATTTAATGTTGG + Intergenic
1030606803 7:111646356-111646378 TCTGGAGCTTCTTGTTATGTGGG + Intergenic
1030751530 7:113237242-113237264 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1031321324 7:120332627-120332649 TTTGGAGCTTCTTTTAAAGGAGG + Intronic
1031399954 7:121317618-121317640 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1031405450 7:121380368-121380390 TATATAGCTTTTTTTAATGTAGG - Intronic
1031525563 7:122818967-122818989 TTTGGAGTTTTATTTAATGTCGG - Intronic
1031685815 7:124731086-124731108 TTTGGAGTTTTATTTAATGTTGG - Intergenic
1031727962 7:125262566-125262588 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1031776294 7:125912035-125912057 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1033084687 7:138331048-138331070 TTTGGAGCTTTATTTAATGTCGG - Intergenic
1033465066 7:141582476-141582498 TTTGGAGTTTTATTTAATGTTGG + Intronic
1033625557 7:143106870-143106892 TTTGGAGCTTTTTCTAATGTCGG - Intergenic
1033675981 7:143540886-143540908 TTTGGAGTTTTATTTGATGTCGG + Intergenic
1033695854 7:143788553-143788575 TTTGGAGTTTTATTTGATGTCGG - Intergenic
1033909495 7:146247043-146247065 TTTGGAGTTGTATTTAATGTCGG + Intronic
1034635506 7:152564269-152564291 TACTCAGCTTTTTCTAATGTTGG + Intergenic
1035599119 8:885413-885435 TTTGGCTCTTTGTCTATTGTTGG + Intergenic
1035880695 8:3241907-3241929 TTTGGAGTTTTATTTAATGCCGG + Intronic
1035930158 8:3771508-3771530 TTTGGAGCTTCTGCTCATTTGGG + Intronic
1036070957 8:5440327-5440349 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1036107750 8:5859222-5859244 TTTGGGGCTATATCTAAAGTTGG + Intergenic
1036281452 8:7404484-7404506 TTTGGAGTTTTATTTAATGTTGG - Intergenic
1036340017 8:7907088-7907110 TTTGGAGTTTTATTTAATGTTGG + Intergenic
1036372100 8:8170627-8170649 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1036472365 8:9063125-9063147 TTTGGAGCTTTATTTAATGTCGG + Intronic
1036639460 8:10573293-10573315 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1036848489 8:12185697-12185719 TTTGCAGCTTTCTCTAATAAGGG - Intronic
1036869849 8:12427978-12428000 TTTGCAGCTTTCTCTAATAAGGG - Intronic
1036878801 8:12495014-12495036 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1038257284 8:25961800-25961822 TTTGGTTCATTTTCTACTGTAGG - Intronic
1038860566 8:31384205-31384227 TTTGAAGTTTTTTGTTATGTAGG - Intergenic
1039395001 8:37218051-37218073 TTTGGAGCTTGTTATGATGATGG - Intergenic
1039499023 8:38002368-38002390 TTTGGAGCTTTTCCTAATTTTGG + Intergenic
1039503101 8:38032073-38032095 TTTGGAGTTCTTTCAAATGAGGG + Intronic
1039997350 8:42545397-42545419 TTTAGAGCTTTATCTAGTTTTGG - Intronic
1041917568 8:63151987-63152009 TTTGGAGCTTTTTCTAATGTCGG + Intergenic
1042056104 8:64766386-64766408 TTTGAAGTTTTTTCTAATGTCGG - Intronic
1042066974 8:64888432-64888454 TATGGAGCTTTTTATAATTCAGG - Intergenic
1042453526 8:68975218-68975240 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1042628819 8:70792726-70792748 TTTGCAACTTTTGGTAATGTTGG - Intergenic
1042706055 8:71666451-71666473 TTTGGAGCTTTACTTAAAGTTGG - Intergenic
1042707338 8:71676958-71676980 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1042954900 8:74239140-74239162 TTTGCAGGTTTTTATAATGCTGG + Intronic
1043015558 8:74936048-74936070 TTTGGAGGTTCTTATAATGAAGG + Intergenic
1043353702 8:79389769-79389791 TTTGGAGTTTAATTTAATGTTGG + Intergenic
1043543805 8:81292945-81292967 TTTGGAGCTTTTTGTATTTTGGG + Intergenic
1043597482 8:81902200-81902222 TTTTGAGCTTTATTTAATGTTGG + Intergenic
1043717923 8:83508805-83508827 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1043720877 8:83545989-83546011 TTTGGAGCTTTTTCTAATGTCGG - Intergenic
1043837703 8:85064993-85065015 TTTGGAGCTTTATTTCATGTCGG - Intergenic
1044148542 8:88745879-88745901 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1044417052 8:91950015-91950037 TTTGGAGTTTTATTTAATGTGGG - Intergenic
1044804262 8:95988911-95988933 ATTTGAGCTTTTTCAAGTGTAGG - Intergenic
1045174815 8:99711063-99711085 GTTGTAGCTTTTTTTAATGTAGG + Intronic
1045197491 8:99945916-99945938 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1045251562 8:100487198-100487220 TTGGGATCTTTTTTTAATGGTGG + Intergenic
1045644751 8:104287980-104288002 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1046294090 8:112197869-112197891 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1046386374 8:113513177-113513199 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1046439982 8:114243383-114243405 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1046443217 8:114284038-114284060 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1046512053 8:115214272-115214294 TTTGGAGTTTTACTTAATGTTGG - Intergenic
1046559252 8:115816654-115816676 TTTGGAGTTTTATTTAATGTTGG - Intergenic
1046958284 8:120083794-120083816 TTTGCAGTTTTTCGTAATGTAGG - Intronic
1046964204 8:120145302-120145324 TTTTAAGGTTTTTCTAATATAGG - Intronic
1047699316 8:127433774-127433796 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1047829571 8:128615572-128615594 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1047856339 8:128916438-128916460 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1048097581 8:131312227-131312249 TTTGGAGCTTTATTTAATGTCGG - Intergenic
1048135437 8:131742745-131742767 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1048143739 8:131821207-131821229 TTTGGAGCTTTATTTCATGTCGG - Intergenic
1048168466 8:132083901-132083923 TTTGGAGTTTTATTTAATGTCGG + Intronic
1048202522 8:132387250-132387272 ATTGGAAACTTTTCTAATGTTGG - Intronic
1048585451 8:135770811-135770833 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1048728455 8:137411966-137411988 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1048764266 8:137828509-137828531 TTTGGAGTTTTATTTAATGTTGG + Intergenic
1049538416 8:143193860-143193882 TTTGAAGTTTCTTCTGATGTAGG - Intergenic
1050071966 9:1824626-1824648 TTTGTAGCGTTTTCTACTTTTGG + Intergenic
1050140448 9:2511454-2511476 TTTGGAGGTTTTTCTAATGTTGG - Intergenic
1050168873 9:2794971-2794993 TTTGGAGCTGTCTCTACTATAGG + Intronic
1050258139 9:3814842-3814864 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1050474138 9:6022023-6022045 TTCAGAGCTTTATTTAATGTCGG - Intergenic
1050568482 9:6912644-6912666 TTTGCAGCTTTAACTAATTTTGG + Intronic
1050628515 9:7534264-7534286 GTTGGAGCTGTTTCTATGGTAGG + Intergenic
1050650381 9:7769322-7769344 TGTGGAGCTTTTTCTAAGTCTGG + Intergenic
1050794097 9:9514830-9514852 TTTGGAGCTATTTCCAGAGTAGG - Intronic
1050805740 9:9676110-9676132 TTTGTAAGTTTTTTTAATGTTGG + Intronic
1051052595 9:12950367-12950389 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1051849316 9:21489365-21489387 TTTGGAGTTTTATTTAATGTTGG + Intergenic
1051953437 9:22662212-22662234 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1052163050 9:25289719-25289741 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1052191803 9:25670947-25670969 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1052421365 9:28246987-28247009 TGTTGAGCTTTTTTTCATGTTGG - Intronic
1052720672 9:32168197-32168219 TTTGGAGCTTCATTTCATGTTGG + Intergenic
1053057994 9:35005508-35005530 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1053059946 9:35022968-35022990 TTTGGAGCTTTTTCTAATGTCGG + Intergenic
1053078488 9:35154896-35154918 TTTGGAGCTTTTTCTAATGTCGG + Intergenic
1054807520 9:69408443-69408465 TTTGGAGTTTCATTTAATGTCGG + Intergenic
1055119436 9:72641457-72641479 TATTGAGCTTTTTCTACTGGAGG - Intronic
1055233030 9:74087710-74087732 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1055347752 9:75355471-75355493 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1055626692 9:78182829-78182851 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1055810015 9:80139456-80139478 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1055881332 9:81007813-81007835 TTTGTCTCATTTTCTAATGTGGG - Intergenic
1056044768 9:82704375-82704397 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1056061130 9:82885804-82885826 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1056323854 9:85460693-85460715 TTTGGAGTTTTATTTAATGTTGG - Intergenic
1056363677 9:85882710-85882732 TCTGGAGCTTTTTTTAATGTCGG - Intergenic
1056437270 9:86586974-86586996 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1056522416 9:87412973-87412995 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1056674411 9:88662150-88662172 TTTGGAGTTGTTTCCAATTTGGG - Intergenic
1056882950 9:90414622-90414644 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1057234814 9:93349652-93349674 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1057377962 9:94541874-94541896 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1057683969 9:97216890-97216912 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1058245712 9:102622806-102622828 TTTGGTGCTGTTTCTTATTTTGG + Intergenic
1058612368 9:106790217-106790239 TTTGGAGTTTTATTTAATGTTGG - Intergenic
1058784856 9:108376990-108377012 CTTAGAGTTTTTTTTAATGTAGG - Intergenic
1059080218 9:111241212-111241234 TTTGGACTTCTTTCCAATGTTGG + Intergenic
1059511822 9:114855361-114855383 TATGGAGGTTTTTATTATGTAGG + Intergenic
1059546192 9:115178310-115178332 TTTGGAGTTTTATTTAATGTCGG + Intronic
1059606737 9:115842868-115842890 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1059863517 9:118489337-118489359 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1060737916 9:126078318-126078340 TTTGGAGTTTTATTTAATGTTGG + Intergenic
1061756804 9:132819505-132819527 TTGGGAGATTTTTTAAATGTTGG + Intronic
1185858461 X:3556789-3556811 TTGGGAGTTTTATTTAATGTCGG + Intergenic
1185872935 X:3679706-3679728 TTTGGGGATTTTTCTAAATTTGG - Intronic
1185960716 X:4544151-4544173 TTTGGAGTTTTATTTAATATCGG + Intergenic
1185991029 X:4893637-4893659 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1186112897 X:6275838-6275860 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1186639420 X:11439533-11439555 TTTGAATCTTTTTCTACTTTTGG + Intronic
1186735567 X:12459709-12459731 TTTGTATTTTTTTCTAATTTTGG + Intronic
1187086554 X:16048350-16048372 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1187103795 X:16220483-16220505 TTTGGAGCTTTTTCTAATGTCGG + Intergenic
1187825039 X:23326497-23326519 TTTGGATTCATTTCTAATGTTGG - Intergenic
1188284312 X:28309733-28309755 TATGGTGCTTTTTCCAATTTTGG + Intergenic
1188301083 X:28506087-28506109 TTTGGAGCTTTATTTAATGTCGG + Intergenic
1188430990 X:30105364-30105386 TTTGGAGTTTTATTAAATGTCGG - Intergenic
1188463406 X:30452757-30452779 TTTGGAGTTTCATTTAATGTTGG + Intergenic
1188762026 X:34044226-34044248 TTTTGAGCTTTCTCTTATTTTGG - Intergenic
1189286471 X:39855416-39855438 TTTGGAGCTGGGTTTAATGTAGG - Intergenic
1190015657 X:46824673-46824695 TTTGGACCTTTTTTCAATTTAGG + Intergenic
1191014226 X:55791968-55791990 TTTGGAGCTTTTTCTAATGTCGG + Intergenic
1191805839 X:65133323-65133345 TTTGGAGCTTTTTCTAATGTCGG + Intergenic
1191825523 X:65361738-65361760 TTTGGAGCTTTTTTTAATGTTGG - Intergenic
1192454569 X:71266230-71266252 TTTGGAGCTTTTTCTAATGTTGG - Intergenic
1193885902 X:86983853-86983875 TTTGGAGTTTTATTTAATGTTGG - Intergenic
1193941467 X:87683937-87683959 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1194186278 X:90776982-90777004 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1194293654 X:92103898-92103920 TTTGGAGTTTTATTTAATGTCGG + Intronic
1194308568 X:92276725-92276747 TTTGGAGTTTTATTTAATGTCGG + Intronic
1194351261 X:92826542-92826564 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1194367077 X:93024981-93025003 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1194430658 X:93800020-93800042 TTGGGAGTTTATTTTAATGTTGG + Intergenic
1194822799 X:98527936-98527958 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1195151497 X:102074983-102075005 TTTCTAACTTTTTTTAATGTGGG - Intergenic
1195291190 X:103433218-103433240 TTTAGAGTTTTATTTAATGTCGG + Intergenic
1195326893 X:103765464-103765486 TTTGGAGTTTTATTTAATGTTGG + Intergenic
1195366219 X:104128268-104128290 TAAAGAGCTTTTGCTAATGTAGG + Intronic
1195443104 X:104920588-104920610 TTGGGAGCTTTTACTCATGGTGG - Intronic
1195586459 X:106570498-106570520 TTTGGAGATATACCTAATGTTGG + Intergenic
1195784282 X:108501765-108501787 CTTAGTGCTTTTTGTAATGTGGG + Intronic
1195841454 X:109180449-109180471 TTTGGAGCTTTATTTAATGTCGG - Intergenic
1195908708 X:109868877-109868899 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1196073054 X:111545965-111545987 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1196165516 X:112532664-112532686 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1196221015 X:113112379-113112401 TTTGGAGCTTTATTTCATGTTGG + Intergenic
1196257737 X:113541808-113541830 TTTATGGCTTTTTCTAGTGTCGG - Intergenic
1196299982 X:114042031-114042053 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1196330793 X:114468811-114468833 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1196496832 X:116332844-116332866 TTTGGAGCTTTATTTAATGTTGG - Intergenic
1196525508 X:116724641-116724663 TTTGGAGCTTTATTGAATGTCGG + Intergenic
1196533568 X:116816126-116816148 TTTGGAGATTTATTTAATGTGGG + Intergenic
1196585094 X:117419685-117419707 TCTGGAGCTTTTTTTAATGTTGG - Intergenic
1196738602 X:119003829-119003851 TTTGTAGCTTTTTCCAATAGAGG + Intronic
1196749861 X:119106313-119106335 TTTGAAGCATTTGCTATTGTGGG + Intronic
1196773882 X:119321428-119321450 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1197002834 X:121458889-121458911 TTTGGAGCATTTTATATTTTTGG - Intergenic
1197064886 X:122224083-122224105 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1197266133 X:124374087-124374109 TTTGGACATTTTCCTAATTTGGG + Intronic
1197352090 X:125392507-125392529 TTTGGAGTTTTATTTAATGTCGG + Intergenic
1197499692 X:127228621-127228643 TTTGGAGCTTTATTTAATGTCGG - Intergenic
1197564521 X:128065595-128065617 TTTGGAGCTTTTACTATTCTGGG - Intergenic
1199135582 X:144247015-144247037 TTTGAAGATTTTTTTTATGTAGG - Intergenic
1199143977 X:144343597-144343619 TTTGAAGCTTTTTCTCTTTTTGG + Intergenic
1199576451 X:149317716-149317738 TTTGGAGTTTTATTTAATGTTGG - Intergenic
1199932975 X:152543711-152543733 TTTGGTGTTTTTTTTAATGTGGG - Intergenic
1200611172 Y:5328444-5328466 TTTGGAGTTTTATTTAATGTCGG + Intronic
1200659584 Y:5943229-5943251 TTTGGAGTTTTATTTAATGTCGG - Intergenic
1201407872 Y:13666493-13666515 TTTGGGTTTTTTTTTAATGTTGG + Intergenic