ID: 1066437384

View in Genome Browser
Species Human (GRCh38)
Location 10:35406915-35406937
Sequence TTGGAGCTTTTTCTAATGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1032
Summary {0: 36, 1: 23, 2: 59, 3: 538, 4: 376}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437368_1066437384 22 Left 1066437368 10:35406870-35406892 CCACCTCCGTCCCCGTCGGGGCG 0: 1
1: 0
2: 48
3: 4016
4: 3547
Right 1066437384 10:35406915-35406937 TTGGAGCTTTTTCTAATGTCGGG 0: 36
1: 23
2: 59
3: 538
4: 376
1066437367_1066437384 23 Left 1066437367 10:35406869-35406891 CCCACCTCCGTCCCCGTCGGGGC 0: 1
1: 0
2: 55
3: 4273
4: 3544
Right 1066437384 10:35406915-35406937 TTGGAGCTTTTTCTAATGTCGGG 0: 36
1: 23
2: 59
3: 538
4: 376
1066437376_1066437384 10 Left 1066437376 10:35406882-35406904 CCGTCGGGGCGGCCGGCCAGGCA 0: 1
1: 0
2: 1
3: 22
4: 151
Right 1066437384 10:35406915-35406937 TTGGAGCTTTTTCTAATGTCGGG 0: 36
1: 23
2: 59
3: 538
4: 376
1066437372_1066437384 16 Left 1066437372 10:35406876-35406898 CCGTCCCCGTCGGGGCGGCCGGC 0: 1
1: 3
2: 71
3: 4210
4: 3025
Right 1066437384 10:35406915-35406937 TTGGAGCTTTTTCTAATGTCGGG 0: 36
1: 23
2: 59
3: 538
4: 376
1066437359_1066437384 28 Left 1066437359 10:35406864-35406886 CCCCCCCCACCTCCGTCCCCGTC 0: 1
1: 0
2: 33
3: 1287
4: 2119
Right 1066437384 10:35406915-35406937 TTGGAGCTTTTTCTAATGTCGGG 0: 36
1: 23
2: 59
3: 538
4: 376
1066437382_1066437384 -6 Left 1066437382 10:35406898-35406920 CCAGGCAGAGGGGCTTTTTGGAG 0: 1
1: 0
2: 3
3: 15
4: 202
Right 1066437384 10:35406915-35406937 TTGGAGCTTTTTCTAATGTCGGG 0: 36
1: 23
2: 59
3: 538
4: 376
1066437361_1066437384 26 Left 1066437361 10:35406866-35406888 CCCCCCACCTCCGTCCCCGTCGG 0: 1
1: 0
2: 59
3: 4608
4: 3364
Right 1066437384 10:35406915-35406937 TTGGAGCTTTTTCTAATGTCGGG 0: 36
1: 23
2: 59
3: 538
4: 376
1066437370_1066437384 19 Left 1066437370 10:35406873-35406895 CCTCCGTCCCCGTCGGGGCGGCC 0: 1
1: 0
2: 3
3: 104
4: 4660
Right 1066437384 10:35406915-35406937 TTGGAGCTTTTTCTAATGTCGGG 0: 36
1: 23
2: 59
3: 538
4: 376
1066437380_1066437384 -2 Left 1066437380 10:35406894-35406916 CCGGCCAGGCAGAGGGGCTTTTT 0: 1
1: 0
2: 2
3: 44
4: 256
Right 1066437384 10:35406915-35406937 TTGGAGCTTTTTCTAATGTCGGG 0: 36
1: 23
2: 59
3: 538
4: 376
1066437363_1066437384 25 Left 1066437363 10:35406867-35406889 CCCCCACCTCCGTCCCCGTCGGG 0: 1
1: 0
2: 62
3: 5118
4: 3550
Right 1066437384 10:35406915-35406937 TTGGAGCTTTTTCTAATGTCGGG 0: 36
1: 23
2: 59
3: 538
4: 376
1066437373_1066437384 12 Left 1066437373 10:35406880-35406902 CCCCGTCGGGGCGGCCGGCCAGG 0: 1
1: 3
2: 20
3: 835
4: 9782
Right 1066437384 10:35406915-35406937 TTGGAGCTTTTTCTAATGTCGGG 0: 36
1: 23
2: 59
3: 538
4: 376
1066437358_1066437384 29 Left 1066437358 10:35406863-35406885 CCCCCCCCCACCTCCGTCCCCGT 0: 1
1: 1
2: 12
3: 450
4: 1610
Right 1066437384 10:35406915-35406937 TTGGAGCTTTTTCTAATGTCGGG 0: 36
1: 23
2: 59
3: 538
4: 376
1066437375_1066437384 11 Left 1066437375 10:35406881-35406903 CCCGTCGGGGCGGCCGGCCAGGC 0: 4
1: 13
2: 693
3: 5588
4: 7319
Right 1066437384 10:35406915-35406937 TTGGAGCTTTTTCTAATGTCGGG 0: 36
1: 23
2: 59
3: 538
4: 376
1066437360_1066437384 27 Left 1066437360 10:35406865-35406887 CCCCCCCACCTCCGTCCCCGTCG 0: 1
1: 0
2: 47
3: 3746
4: 2848
Right 1066437384 10:35406915-35406937 TTGGAGCTTTTTCTAATGTCGGG 0: 36
1: 23
2: 59
3: 538
4: 376
1066437365_1066437384 24 Left 1066437365 10:35406868-35406890 CCCCACCTCCGTCCCCGTCGGGG 0: 1
1: 0
2: 58
3: 5067
4: 3416
Right 1066437384 10:35406915-35406937 TTGGAGCTTTTTCTAATGTCGGG 0: 36
1: 23
2: 59
3: 538
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066437384 Original CRISPR TTGGAGCTTTTTCTAATGTC GGG Intronic
900722571 1:4186920-4186942 TTGGAGTTTTATTTAATGTCAGG + Intergenic
900840757 1:5046895-5046917 TTGGAGTTTTATTTAATGTCGGG - Intergenic
900847443 1:5115166-5115188 TTGGAGTTTTATTTAATGTCGGG - Intergenic
902050894 1:13562916-13562938 TTGGAGCTTTTTCTAATGTCAGG - Intergenic
903396057 1:23002637-23002659 TTGGAGCTTTTTCTAATGTCAGG + Intergenic
904393933 1:30205440-30205462 TTGGAGCTTTTTCTAATGTTGGG - Intergenic
904711607 1:32434368-32434390 TTGGAGTTTTATTTAATGTCAGG - Intergenic
904996508 1:34635620-34635642 TTGGAGTTTTATTTAATGTTGGG + Intergenic
905060547 1:35135993-35136015 TTGGAGCTTTATTTAAAGTCGGG + Intergenic
905429261 1:37909701-37909723 TTGGAGATTTTTCTAATGTCAGG - Intronic
906080892 1:43087530-43087552 TTGGAGTTTTATTTAATGTCGGG - Intergenic
906744550 1:48212652-48212674 TTGGAGTTTTATTTAATGTCGGG + Intergenic
907292602 1:53426317-53426339 TTGGAGTTTTATTTAATGTCGGG - Intergenic
907293572 1:53434272-53434294 TTGGAGCTTTTTCTAATGTCAGG - Intergenic
907503596 1:54901523-54901545 TTGGAGTTTTATTTAATGTCGGG + Intergenic
907521233 1:55024648-55024670 TTGGAGTTTTATTTAATGTCAGG - Intergenic
908461742 1:64353630-64353652 TTGGAGTTTTATTTAATGTCGGG + Intergenic
908852376 1:68388313-68388335 TCGGAGTTTTATTTAATGTCGGG - Intergenic
909014684 1:70369419-70369441 TTGGAGCTTTATTTAATGTTGGG - Intronic
909035443 1:70590328-70590350 TTGGAGCTTTATTTCATGTCGGG - Intergenic
909222687 1:72983495-72983517 TTGGAGTTTTATTTAATGTCGGG + Intergenic
909223680 1:72991446-72991468 TTGGAGTTTTATTTAATGTCGGG + Intergenic
909551050 1:76898462-76898484 TTGGAGTTTTATTTAATGTCAGG + Intronic
909776722 1:79492225-79492247 TTGGAGTTTTATTTAATGTCGGG + Intergenic
909788296 1:79642413-79642435 TTGGAGTTTTATTTAACGTCAGG + Intergenic
909793005 1:79700007-79700029 TTGGAGTTTTATTTAATGTCGGG + Intergenic
909909934 1:81247487-81247509 TTGGAGTTCTATTTAATGTCAGG - Intergenic
910049352 1:82957364-82957386 TTGGAGCTTTATTTAAAGTCAGG - Intergenic
910741813 1:90527631-90527653 TTGAAGCTTTAACTACTGTCAGG + Intergenic
911071048 1:93832081-93832103 ACGGAGCTTTTTCTAATGTCAGG - Intronic
911148017 1:94570547-94570569 TTGGAGCTTTTTCTACTGTCGGG + Intergenic
911510645 1:98804929-98804951 TTGGAGCTTTATTTAACGTCGGG + Intergenic
911570375 1:99511685-99511707 TTGGAGTTTTATTTAATGTCGGG - Intergenic
911620336 1:100059909-100059931 TTGGTGCTCTTTCTGATGTTTGG + Exonic
911759815 1:101601722-101601744 TTGGAGTTTTATTTAATGTCGGG + Intergenic
911966897 1:104382209-104382231 TTGGAGCTTTTTGTAATGTTGGG - Intergenic
912296448 1:108474999-108475021 TTGGAGTTTTATTTAATGTCGGG - Intergenic
912813533 1:112811461-112811483 TTGGAGTTTTATTTAATGCCGGG - Intergenic
912815341 1:112824172-112824194 TTGGAGCTTTATTTAATGTCGGG + Intergenic
913060349 1:115198954-115198976 CAGAAGCTTTTTCCAATGTCTGG + Intergenic
913245101 1:116864152-116864174 TTGGAGCTTTTTTTAGTGTTGGG - Intergenic
913274673 1:117125273-117125295 TTGAAGCTTTCTCTTATTTCAGG + Intergenic
916328837 1:163593069-163593091 TTGGAGTTTTATTTAATGTCAGG - Intergenic
916941765 1:169684888-169684910 TTGGAGCTTTTTCTAATGTTGGG - Intronic
918347087 1:183615695-183615717 TTGGAGTTTTATTTAATGTCGGG - Intergenic
918545748 1:185681597-185681619 TTGCAGCTTTCTCTAATATGGGG - Intergenic
918567700 1:185951962-185951984 TTGGAGTTTTATTTAATGTCGGG + Intronic
918714435 1:187769159-187769181 TTGGAGTTTTATTTAATGTCGGG + Intergenic
918996740 1:191771716-191771738 TTGGAGTTTTTTCTGTGGTCGGG - Intergenic
919090959 1:192978790-192978812 TTGGAGTTTTATTTAATGTCAGG + Intergenic
919170089 1:193942901-193942923 TTGGAGGTTTTTCAAATGAAAGG - Intergenic
919476369 1:198036841-198036863 TTGGATTTTTATTTAATGTCAGG - Intergenic
920829376 1:209450984-209451006 TTGGAGTTTTATTTAATGTCGGG - Intergenic
920901557 1:210114475-210114497 TTGGAGCTTTATTTAATATTGGG + Intronic
921086536 1:211799027-211799049 TAGGAGGTTTTTCAAAAGTCTGG - Intronic
921212391 1:212911553-212911575 TTGGAGTTTTATTTAATGTCGGG - Intergenic
921452609 1:215325987-215326009 GTGGAGCTCTTTCTAAAGCCTGG + Intergenic
921459809 1:215413606-215413628 TTGGAGTTTTATTTAATGTCGGG + Intergenic
921509230 1:216010054-216010076 TTGGAGTTTTATTTAATGTCGGG - Intronic
921520100 1:216147595-216147617 TTGGAGTTTTATTTAATGTCGGG - Intronic
921733003 1:218597455-218597477 TTGGAGTTTTATTTAATGTCGGG + Intergenic
922048384 1:221968003-221968025 TTGGAGTTTTATTTAATGTCAGG - Intergenic
922049562 1:221976769-221976791 TTGGAGTTTTATTTAATGTCGGG + Intergenic
922154098 1:223028069-223028091 TTGGAGTTTTATTTAATGTCGGG + Intergenic
922363575 1:224844149-224844171 TTGGAGTTTTATTTAATGTCAGG + Intergenic
922598949 1:226835288-226835310 TTGCAGCTTTTTCTAATATCGGG - Intergenic
922877056 1:228948283-228948305 TTGGAGTTTTATTTAATGTCGGG - Intergenic
922906371 1:229176467-229176489 TTGGAGTTTTATTTAATGTTGGG - Intergenic
922934796 1:229414432-229414454 TTGGAGTTTTATTTAATGTCAGG - Intergenic
923075178 1:230603277-230603299 TTGGAGTTTTATTTAATGTCGGG - Intergenic
923257301 1:232232865-232232887 TTGGAGTTTTATTTAATGTCGGG + Intergenic
923408649 1:233687096-233687118 TTGGAGTTTTATTTAATGTCAGG + Intergenic
923770767 1:236935917-236935939 TTGGAGTTTTATTTAATGTTGGG + Intergenic
923888081 1:238180282-238180304 TTGGAGTTTTGTCTGATGTCTGG - Intergenic
923950926 1:238952916-238952938 ATGCTGCTTTTTCTCATGTCGGG - Intergenic
923962757 1:239103397-239103419 TTGGAGTTTTATTTAATGTCGGG - Intergenic
924180628 1:241436007-241436029 TTGGAGTTTTATTTAATGTCGGG - Intergenic
924570204 1:245230900-245230922 TTTGAGATTTTTCAAATTTCTGG - Intronic
924896209 1:248339892-248339914 TTGGAGCTTTATTTAAAGTCAGG + Intergenic
1062930724 10:1350768-1350790 TTGGAGTTTTATTTAATGTCGGG - Intronic
1063106439 10:2996673-2996695 TTGGAGCTTTATTTAATCTCAGG + Intergenic
1063363137 10:5473136-5473158 TTGGAGCTTTATTTAATGTCGGG - Intergenic
1063509628 10:6633258-6633280 TTGGAGTTTTATTTAGTGTCGGG + Intergenic
1063527711 10:6800755-6800777 TTGGAGTTTTATTTAGTGTCGGG + Intergenic
1063605178 10:7517125-7517147 TTGGAGCTTTTGCCAGTCTCAGG + Intergenic
1064663839 10:17630508-17630530 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1064887021 10:20122823-20122845 TTGGAGTTTTATTTAGTGTCGGG + Intronic
1065437601 10:25718462-25718484 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1065443147 10:25772403-25772425 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1065759005 10:28964363-28964385 TTGGAGATTTTCCCACTGTCGGG + Intergenic
1066103425 10:32137346-32137368 TTGGCACTTGTTCTAATGTTGGG + Intergenic
1066437384 10:35406915-35406937 TTGGAGCTTTTTCTAATGTCGGG + Intronic
1067147649 10:43704814-43704836 TTGAAGCTTTTCCTCCTGTCTGG - Intergenic
1067360373 10:45573234-45573256 TAGGAGTTTTATTTAATGTCAGG - Intronic
1068058377 10:52037426-52037448 TTGGAGTTTTATTTAATGTCTGG + Intronic
1068179683 10:53502697-53502719 TTGGAGTTTTATTTAATGTCTGG + Intergenic
1068230946 10:54168803-54168825 TTGGAGTTTTATTTAATGTCAGG - Intronic
1068360752 10:55973247-55973269 TTGGAGCTTTATTTAATGTCAGG - Intergenic
1068592372 10:58864681-58864703 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1068725635 10:60299397-60299419 TTGTTGCTTGTTCTAATATCAGG - Intronic
1069159585 10:65077635-65077657 TTTGAACTTTTTCCAATGTAGGG + Intergenic
1069792339 10:71030804-71030826 TAGGAGCCTTTTCTATTGTGGGG + Intergenic
1070474901 10:76820617-76820639 TTGGAGTTTTACTTAATGTCGGG - Intergenic
1071550817 10:86564928-86564950 TTGGAGCTTTTTCTAATGTCAGG + Intergenic
1071821713 10:89286716-89286738 TTGGAGTTTTATTTAATGTTGGG - Intronic
1071853593 10:89600573-89600595 TTGGCTCTTTTATTAATGTCTGG + Intronic
1071897761 10:90084704-90084726 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1071916175 10:90297053-90297075 TTGGAGTTTTATTTAATGTTGGG - Intergenic
1071961084 10:90809474-90809496 TTGGAGTTTTATTTAATGTTGGG - Intronic
1072011307 10:91305177-91305199 TTGGAGCTTTATTTCATGTTGGG + Intergenic
1072313949 10:94183747-94183769 TCGGAGCTTTTACTCATGGCGGG + Intronic
1072580232 10:96734260-96734282 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1072884502 10:99261638-99261660 TTGGAGCTTTCTCTAATGTCAGG - Intergenic
1073013993 10:100383777-100383799 TTGGAGCTTTTTCTAATGTCCGG - Intergenic
1073683506 10:105729412-105729434 TTGGAGCTTTATTTAAAGTCGGG - Intergenic
1073709513 10:106021283-106021305 TTGGAGCTTTATTTAAAGTCGGG + Intergenic
1073822008 10:107274825-107274847 CTGGTGCTTTTTGTAATCTCTGG - Intergenic
1073933183 10:108599854-108599876 TTGGAGCTTTATTTAATGTCGGG - Intergenic
1074018999 10:109564386-109564408 TTGGAGCTTTATTTAATGTCTGG - Intergenic
1074740750 10:116482701-116482723 TTGGAGTTTTATTTAATGTTGGG - Intergenic
1074794363 10:116926336-116926358 TTTGATCTTTCTCTAAGGTCTGG - Intronic
1074861832 10:117515995-117516017 TTATATCTTTTTCTAAAGTCAGG - Intergenic
1075248670 10:120846897-120846919 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1075981829 10:126746905-126746927 TGGGAGCTACTTCTAAAGTCTGG - Intergenic
1077589907 11:3483325-3483347 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1077612157 11:3649956-3649978 TTGGAGTTTTATTTAATGTCAGG - Intronic
1077766412 11:5163975-5163997 TTGGAGTTTTATTTAATGTCAGG + Intronic
1077850824 11:6073501-6073523 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1077883324 11:6367834-6367856 TTGGAGCTTTATTTAATGTCGGG - Intergenic
1078046153 11:7915825-7915847 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1079230487 11:18645051-18645073 TTGGAGCTTTTTCTAATATTGGG - Intergenic
1079447435 11:20569837-20569859 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1079672598 11:23187603-23187625 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1079727099 11:23890844-23890866 TTGGAGTTTTATTTAATGTTGGG + Intergenic
1079847721 11:25490910-25490932 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1080027943 11:27632748-27632770 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1081356777 11:42122624-42122646 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1082197782 11:49325095-49325117 TTGAAGCTTTTTTTTAAGTCAGG + Intergenic
1083287990 11:61673046-61673068 TTGGAGCTTTTTCCAGTTTGGGG - Intergenic
1083591418 11:63897536-63897558 GTGGGGCTTTTTGTAATTTCAGG - Intronic
1084047137 11:66575644-66575666 TTGGATTTTTATTTAATGTCGGG - Intergenic
1084232275 11:67761732-67761754 TTGGAGTTTTATTTAATGTAGGG - Intergenic
1084245626 11:67855099-67855121 TTGGAATTTTATTTAATGTCGGG + Intergenic
1084355523 11:68635759-68635781 TTGGAGTTTTATTTAATGTTGGG - Intergenic
1084613304 11:70217967-70217989 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1084827060 11:71739479-71739501 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1085570166 11:77551953-77551975 TTGGAGCTTTTTCTAATGTCAGG - Intronic
1085927713 11:81041113-81041135 TTGGAGCTGTTAGTAATGTCTGG - Intergenic
1085934241 11:81123872-81123894 TTGGAGCTTTATTTAAAGTTGGG - Intergenic
1085987987 11:81808236-81808258 TTGGAGTTTTATTTAATGTTGGG - Intergenic
1086004989 11:82027241-82027263 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1086134867 11:83435272-83435294 TTGGAGCTTTATTTAATGTCGGG + Intergenic
1086136302 11:83446594-83446616 TTGGAGTTTTATTTAATGTTGGG + Intergenic
1086550178 11:88045212-88045234 TTGGAGCTTTATTTAATGTCGGG - Intergenic
1087099070 11:94347742-94347764 TTGGAGTTTTATTTAATGTTGGG - Intergenic
1087099612 11:94351673-94351695 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1087127791 11:94643665-94643687 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1087196889 11:95311578-95311600 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1087314651 11:96589972-96589994 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1087674799 11:101148375-101148397 TTGGAGCTTATTCTTATTTATGG + Intergenic
1087704637 11:101476621-101476643 TTGAAGGGTTTTGTAATGTCAGG - Intronic
1087839569 11:102907770-102907792 TTGGAGTTTTATTTAATGTTGGG + Intergenic
1088554931 11:111052215-111052237 TTGGAGCTTTATTTCATGTCGGG - Intergenic
1088726332 11:112639080-112639102 TTGCACCTTTTTCGAAAGTCAGG + Intergenic
1089349068 11:117811330-117811352 TTGGAGTTTTATTTAATGTCGGG - Intronic
1089471083 11:118720663-118720685 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1089867080 11:121641612-121641634 TTGGAGCTTTCTTTCATGTTGGG + Intergenic
1089973862 11:122715937-122715959 CTGGAGCATTTTCAAATGACAGG - Intronic
1089987658 11:122829170-122829192 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1090107629 11:123869289-123869311 TTGGAGTTTTATTTAATGTTGGG + Intergenic
1090354415 11:126130222-126130244 TTGAACCTTTTTCTACTGTGTGG + Intergenic
1090526838 11:127546423-127546445 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1090546517 11:127772767-127772789 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1090850624 11:130568027-130568049 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1090871984 11:130757170-130757192 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1090926966 11:131258150-131258172 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1091183645 11:133628833-133628855 TTGGAGTTTTATTTAATGTTGGG - Intergenic
1091886485 12:4020578-4020600 TTGGAGTTTTATTTAATGTTGGG - Intergenic
1091920691 12:4302397-4302419 TTGGAGCTTTTTCAAAAGCGGGG + Exonic
1092416206 12:8292230-8292252 TTGGAGTTTTATTTAACGTCGGG + Intergenic
1092474461 12:8806985-8807007 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1092592782 12:9966758-9966780 TTGGAGTTTTATTTAATGTCGGG + Intronic
1092626771 12:10336593-10336615 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1092723746 12:11465834-11465856 TTGGAGTTTTATTTAATGTCAGG + Intronic
1092739352 12:11613359-11613381 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1092789681 12:12060440-12060462 TTGGAGTTTTATTTAATGTCGGG - Intronic
1092924879 12:13263635-13263657 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1093024302 12:14232600-14232622 TTGGAGCTTTTTGTAACGTCGGG - Intergenic
1093071190 12:14708534-14708556 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1093268039 12:17025368-17025390 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1093302209 12:17471597-17471619 TGGGGGCTTTTTCTAATGTCCGG - Intergenic
1093322018 12:17723964-17723986 TTGGAGTTTTACATAATGTCGGG + Intergenic
1093358402 12:18196976-18196998 TTGGAGTTTTATTTAATGTAGGG - Intronic
1093578790 12:20765424-20765446 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1093584545 12:20820666-20820688 TTGGAGTTTTATTTAATGTCAGG + Intronic
1093812866 12:23509702-23509724 TTGGAGTTTTATTTAATGTCCGG + Intergenic
1093951045 12:25165170-25165192 TTGAAGTTTTATTTAATGTCCGG - Intronic
1094316084 12:29138689-29138711 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1094400643 12:30057997-30058019 TTGGAGTTTTATTTAATGTCCGG - Intergenic
1094825729 12:34267685-34267707 TTGGAGTTTTATTTAATGTTTGG - Intergenic
1095162864 12:38937298-38937320 TTGCAGCTTTTTCTTGTGTTTGG + Intergenic
1095999054 12:48113812-48113834 TTGAAGATTTTTCTAATGTCAGG + Intronic
1096907211 12:54946591-54946613 TTGGAGCTTTATTTAATGTTGGG + Intergenic
1097398558 12:59103887-59103909 TTGGGGTTTTATTTAATGTCGGG - Intergenic
1097417083 12:59326883-59326905 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1097542227 12:60955675-60955697 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1098125286 12:67285635-67285657 ATGGACCTTTTTCAAATGACTGG + Intronic
1098173668 12:67770312-67770334 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1098400352 12:70068676-70068698 TTGGAGTTTATTCTTATGTATGG + Intergenic
1098402219 12:70087447-70087469 TTGGAGTTTTATTTAATGTTGGG - Intergenic
1098629034 12:72705397-72705419 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1098630057 12:72712558-72712580 TTGGAGCTTTATTTAAAGGCAGG + Intergenic
1098653857 12:73005650-73005672 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1098919884 12:76293481-76293503 TTGGAGCTTTTTCTACTGTCAGG - Intergenic
1099188687 12:79541907-79541929 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1099251143 12:80256539-80256561 TGGGATCTTTTCCTAATGTTAGG + Intronic
1099292129 12:80786741-80786763 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1099664445 12:85609721-85609743 TTTGAGCTTTTTATAATGTCAGG + Intergenic
1099762558 12:86940847-86940869 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1099836126 12:87911076-87911098 TTGGAGTTTTATTTAATGTTGGG + Intergenic
1100561320 12:95751137-95751159 TTGGAGTTTTATTTAATGTCGGG - Intronic
1100940261 12:99717208-99717230 TTGGAGTTTTATTTAATGTTGGG - Intronic
1101278427 12:103226344-103226366 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1102155436 12:110723680-110723702 TTACAACTTTTTCTAATGACAGG + Intronic
1102260886 12:111442685-111442707 CTTGAGCTTTTTCTAAGGTGGGG - Intronic
1102414537 12:112749129-112749151 TTTCAGCTTTTTCTAGAGTCAGG + Intronic
1102588064 12:113937056-113937078 TTGGAGCTTTTTCTTCTGTGGGG + Exonic
1102615850 12:114153488-114153510 TGGGTGGATTTTCTAATGTCTGG - Intergenic
1105354738 13:19649470-19649492 TTGGGGTTATTTCTTATGTCAGG + Intronic
1106882452 13:34146579-34146601 TAGGATCCCTTTCTAATGTCAGG - Intergenic
1106943416 13:34800691-34800713 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1107045918 13:35991918-35991940 ATCAAGCTTTTTCTAATGCCTGG + Intronic
1107075549 13:36318490-36318512 TTGGAGTTATATTTAATGTCAGG - Intronic
1107220324 13:37972865-37972887 TTGGAGTTCTATTTAATGTCGGG + Intergenic
1108282096 13:48870813-48870835 TTGGAGCTTTTTCTAATATCGGG + Intergenic
1108512966 13:51171915-51171937 TTGGAGTTTTATTTAATATCGGG - Intergenic
1108803904 13:54131381-54131403 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1108814099 13:54268905-54268927 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1108913448 13:55581909-55581931 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1108919573 13:55658638-55658660 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1108947409 13:56042359-56042381 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1108952974 13:56116082-56116104 TTGGAGTTTTACTTAATGTCGGG + Intergenic
1109352886 13:61206808-61206830 TTGGAGTTTTATTTGATGTCGGG - Intergenic
1109499268 13:63215171-63215193 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1109709694 13:66145001-66145023 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1109716771 13:66230040-66230062 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1109730772 13:66410562-66410584 CTGGAGCATTTCCAAATGTCTGG - Intronic
1110108093 13:71705318-71705340 TTAGAGCATTTTCTAGTTTCTGG - Intronic
1110518249 13:76442503-76442525 TTGGGTCTTTTTCTAGTCTCTGG + Intergenic
1110689122 13:78411439-78411461 TTAGAGCTATTTCAATTGTCAGG + Intergenic
1110765449 13:79276183-79276205 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1110845315 13:80185706-80185728 TTGGAGCTTTATTTCATGTCAGG - Intergenic
1110909198 13:80933984-80934006 TTGGAGCATCTTATAATGCCAGG - Intergenic
1110978461 13:81868196-81868218 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1111302020 13:86360454-86360476 TTTGAGTTTTATTTAATGTCGGG - Intergenic
1111362139 13:87190117-87190139 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1111631734 13:90852251-90852273 TTGGAGTTTTATTTAATGTGGGG + Intergenic
1112236800 13:97644365-97644387 TTGGAGTTTTATTTAATATCGGG - Intergenic
1112889348 13:104211742-104211764 TTGGAGTTTTATTTAATATCGGG + Intergenic
1112905004 13:104406616-104406638 TTTGAGCTTTTTAAAATGTCAGG - Intergenic
1113324308 13:109267391-109267413 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1114264980 14:21068702-21068724 TTGGAGCTCTTTCTAACACCCGG - Intronic
1114771075 14:25429371-25429393 TTGGAGCTTTTTCTAATGTCGGG + Intergenic
1115904780 14:38192839-38192861 TTGGAGTTTTATTTAATATCGGG - Intergenic
1116043929 14:39719928-39719950 TTTAATCTTTTTCTGATGTCTGG + Intergenic
1116179649 14:41517990-41518012 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1116490616 14:45499073-45499095 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1116534806 14:46016068-46016090 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1116573428 14:46545975-46545997 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1116613484 14:47106229-47106251 TTGGAGTTTTATTTAATGTCGGG - Intronic
1116702435 14:48259071-48259093 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1116952884 14:50895219-50895241 TTGGAGTTTTATTTAATGTCGGG - Intronic
1117801152 14:59446082-59446104 TTGGAGTTTTATTTAATGTCGGG - Intronic
1118733494 14:68685678-68685700 GTGGAGCTTTTTCTGCTGTGAGG - Intronic
1119022401 14:71126350-71126372 TTGGAGTTTTATTTAATGCCGGG - Intergenic
1119163078 14:72469522-72469544 TTCATGCTTTTTCTAATGTCAGG - Intronic
1119317171 14:73705539-73705561 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1120102180 14:80457950-80457972 TGTGAGCATTTTCTAATGCCTGG - Intergenic
1120251424 14:82064772-82064794 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1120438078 14:84503869-84503891 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1120539593 14:85736664-85736686 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1121193332 14:92048400-92048422 TTGGAGCTTTTTCTAATGTCGGG + Exonic
1121703619 14:95974969-95974991 TTGGAGTTTTATTTAATGTTGGG - Intergenic
1121980611 14:98450814-98450836 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1122095867 14:99371235-99371257 TTGGAGATTTTTCTATTTTAGGG + Intergenic
1122381349 14:101309335-101309357 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1122507606 14:102241650-102241672 TTGGAGCTTTTTCTAATGTCAGG - Intronic
1123882521 15:24689243-24689265 TTGGAGCTTTATTTAAAGTTGGG + Intergenic
1125045747 15:35240818-35240840 TTGGAGTTTTATTTAATGTCGGG - Intronic
1125131543 15:36289305-36289327 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1125213251 15:37239887-37239909 TTGGAGCTTTATTTAATGTCGGG + Intergenic
1125849066 15:42886574-42886596 TTTGGAGTTTTTCTAATGTCGGG - Intronic
1126374225 15:47978833-47978855 TTGGAGTTTCTTATAATTTCTGG - Intergenic
1126384872 15:48083934-48083956 TTGGAGCTCTTTCCAATGTATGG + Intergenic
1126530183 15:49702800-49702822 TTGGAGCTTTATTTAAAGTCGGG + Intergenic
1126912432 15:53430497-53430519 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1130304527 15:82704273-82704295 TTGGAGTTTTATTTAATGTTGGG - Intronic
1130855087 15:87833316-87833338 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1130945973 15:88551165-88551187 TTGGAGCTTTATTTAATGACGGG + Intergenic
1131164840 15:90134844-90134866 TTGGAGCTTTATCTAACGTCGGG - Intergenic
1131684150 15:94752796-94752818 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1131684676 15:94756499-94756521 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1131882544 15:96875496-96875518 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1132262985 15:100442308-100442330 TTGGAGTTTTATTTAATGTTGGG - Intronic
1132340384 15:101074585-101074607 TTGGAGTTTTATTTAATGTAGGG - Intronic
1133651370 16:7816752-7816774 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1133765766 16:8836677-8836699 TTGGAGTTTTATTTAATGTCGGG + Intronic
1133766790 16:8843744-8843766 TTGGAGTTTTATTTAATGTCGGG + Intronic
1134342208 16:13356231-13356253 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1135025441 16:18995820-18995842 TTGGAGCTTTTTCCAATGTCAGG + Intronic
1137363406 16:47840561-47840583 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1138804920 16:60080881-60080903 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1139225943 16:65233496-65233518 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1139230630 16:65278913-65278935 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1139943079 16:70620128-70620150 TTGGAGTTTTATTTAATGTCGGG + Intronic
1139943749 16:70624446-70624468 TTGGAATTTTATTTAATGTCGGG + Intronic
1140376684 16:74450450-74450472 TTGGAGCATTTTCCAATGACTGG - Intergenic
1141497353 16:84419373-84419395 TTGGAGATGTGTCTGATGTCAGG - Intronic
1141582587 16:85010572-85010594 TTGTAGCTTCTTTTACTGTCTGG - Intronic
1141837051 16:86548124-86548146 GTGGAGCTTTTTCTTATTCCCGG - Intronic
1141865232 16:86745685-86745707 TTGGACTTTTATTTAATGTCGGG + Intergenic
1143414374 17:6735279-6735301 TTGGAGCTTTATTTAATGTTGGG + Intergenic
1144533219 17:16060494-16060516 TTGCAGATTTTCCTAATCTCAGG + Intronic
1145080694 17:19892121-19892143 TTGGAGCTTTTTCTAATGTCGGG + Intergenic
1146597868 17:34185323-34185345 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1147606367 17:41775949-41775971 GTGGGGCTATTTTTAATGTCAGG - Intronic
1149319493 17:55469504-55469526 TTGGAGCTTTTTCTAATGTCAGG - Intergenic
1150629449 17:66868834-66868856 TTTGAGTTTTTTCTGATGTGAGG - Intronic
1151622459 17:75254596-75254618 TTGGAGTTTTATTTAATGTCGGG - Intronic
1151839784 17:76609615-76609637 TTGGAGTTTTATTTAATATCGGG + Intergenic
1153895034 18:9551201-9551223 ATGTAGCTTTTTCTACTGTAGGG - Intronic
1155697045 18:28696762-28696784 TGGGAGTTTTATTTAATGTCGGG + Intergenic
1155811124 18:30236520-30236542 TTCGAGCTTGTTCTAAATTCTGG + Intergenic
1155892714 18:31287911-31287933 TTTGAGCTTTATTTAATGTTGGG + Intergenic
1155941518 18:31805833-31805855 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1156237326 18:35217792-35217814 TTGGAGCTTTATTTAATGTCGGG - Intergenic
1156251961 18:35359995-35360017 TTGGAGCTTTATTTAATGTCGGG + Intergenic
1156302215 18:35845921-35845943 TTGGGGCATTATTTAATGTCAGG - Intergenic
1156877629 18:42034601-42034623 TTGGTGTTTTTTCTATTGACTGG + Intronic
1156924085 18:42556172-42556194 TTGGAGCTTTATTTCATGTCGGG + Intergenic
1156938503 18:42738676-42738698 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1156958153 18:42992923-42992945 TTGGAGCTTTATTTCATGTCGGG - Intronic
1157906422 18:51573725-51573747 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1158336349 18:56417640-56417662 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1158394669 18:57070287-57070309 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1158576722 18:58644642-58644664 TTGAAGCTTTTTGTAATGTCAGG + Intergenic
1159164438 18:64683690-64683712 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1159694194 18:71533544-71533566 ATGGGTCCTTTTCTAATGTCAGG - Intergenic
1159835023 18:73326686-73326708 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1159929195 18:74294486-74294508 TTGGAGCTTTTTCTAACGTCAGG - Intergenic
1160475322 18:79179593-79179615 TTGGGGATTTTCCCAATGTCTGG + Intronic
1161661688 19:5550520-5550542 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1161711183 19:5849112-5849134 TTGGAGCTTTATTTAATGTCAGG - Intronic
1161712014 19:5854132-5854154 TTGGAGTTTTTTCTAATGTTAGG - Intergenic
1162262181 19:9542258-9542280 TTGGAGCTTTTTCTAGTCTTGGG - Intergenic
1163487256 19:17595452-17595474 TTGGGGTTTTATTTAATGTCAGG - Intergenic
1163907154 19:20157582-20157604 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1164004111 19:21133460-21133482 TTGAAGCTTTCTTTAATGTCAGG + Intergenic
1164080776 19:21859807-21859829 TTGGAGCTTTTTCTAATATTGGG - Intergenic
1164152946 19:22570290-22570312 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1164202528 19:23030481-23030503 TTGGAGTTTTATTTAATGTTGGG + Intergenic
1164258734 19:23551287-23551309 TTGGGGCTTTTTTTAATGTCAGG - Intronic
1164459259 19:28433550-28433572 TTGAAGTTTTATTTAATGTCGGG + Intergenic
1165249207 19:34516017-34516039 TTGGAGTTTTATTTAATGTTGGG - Intergenic
1165497033 19:36159066-36159088 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1165510346 19:36263145-36263167 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1165835327 19:38751638-38751660 TTGGAGTTTTATTTAATGTCGGG - Intronic
1166498970 19:43327163-43327185 CTGGAGTTTTATTTAATGTCGGG + Intergenic
1166905823 19:46107739-46107761 TTGGAACTTTTTCTAATATCGGG + Intergenic
1166927171 19:46277012-46277034 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1167046630 19:47053409-47053431 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1167800919 19:51741169-51741191 TTGCAGATTTTTTAAATGTCTGG + Intergenic
1167902119 19:52629821-52629843 TTGGAGTTTTATTTAATGTCGGG - Intronic
1168051612 19:53833658-53833680 TTGGAGTTTTATTTCATGTCGGG - Intergenic
1168212149 19:54898583-54898605 TTGGAGCTTTATTTAATGTTGGG + Intergenic
1168228016 19:55010438-55010460 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1168248119 19:55124582-55124604 TTGGAGCTTTATTTAATGTCAGG - Intergenic
924960091 2:26922-26944 TTGTTTCTTTTTCTGATGTCAGG + Intergenic
925433881 2:3819564-3819586 TTGGAGCTTTATTTAATGTCAGG + Intronic
925544524 2:5003029-5003051 TTGGAGTTTTATTTAATGTCAGG - Intergenic
925828848 2:7876322-7876344 TTGGAGTTTTATTTAATGTCGGG + Intergenic
926407744 2:12571806-12571828 TTGGAGTTTTATTTAATGTCAGG - Intergenic
926413561 2:12628551-12628573 TTGGAGTTTTATTTAATGTCGGG - Intergenic
926464121 2:13167651-13167673 TTGGAGTTTTATTTCATGTCGGG + Intergenic
926815577 2:16795601-16795623 TTGGAGTTTTATTTAATGTTGGG + Intergenic
926880659 2:17540458-17540480 TTTGAGCTTTTGCTAAAATCTGG + Intronic
927134140 2:20084365-20084387 TTGGAGCTTTATTTAATGTTGGG - Intergenic
928778278 2:34791757-34791779 TTGGAGCTTTATTTAAAGTCGGG - Intergenic
928779709 2:34804545-34804567 TTGGAGTTTTATTTAATGTCAGG + Intergenic
928827686 2:35440780-35440802 TTGGAGTTTTATTTAATGTCGGG + Intergenic
928857138 2:35815106-35815128 TTGGAGTTTTATTTAATGTTGGG - Intergenic
928928533 2:36601085-36601107 TTGGAGTTTTATTTAATGTTGGG - Intronic
929004861 2:37384657-37384679 TTGGAGATTTATTTAATGTCGGG + Intergenic
929035451 2:37687251-37687273 TCAGATCATTTTCTAATGTCTGG + Intronic
929076701 2:38084426-38084448 TTGGAGTTTTATTTAATGTCGGG + Intronic
929534774 2:42774319-42774341 TAGGAGATTTGTCTAAGGTCAGG - Intronic
929684558 2:44022720-44022742 TTAGAGCTTTTTCTAATGCTGGG + Intergenic
929793093 2:45038096-45038118 TAGGAGTTTTATTTAATGTCAGG + Intergenic
930487395 2:52025801-52025823 TTGGAGTTTTATTTAATGTCAGG + Intergenic
930549036 2:52808534-52808556 TTGTAGTTTATTTTAATGTCAGG + Intergenic
930710395 2:54545537-54545559 TGCCAGCTTTTTCTAATGGCAGG - Intronic
930955069 2:57195016-57195038 TTGGAGTTTTATTTAATGTCGGG - Intergenic
930958350 2:57230911-57230933 TTGGAGCTTTATTTAATGTCGGG - Intergenic
931026421 2:58117073-58117095 TTGGAGTTTTATTTAATGTCGGG + Intronic
931042586 2:58315746-58315768 TTGGAGTTTTATTTAATGTCAGG - Intergenic
931236913 2:60419672-60419694 TTGGAGTTTTATTTAATGTCGGG - Intergenic
931608958 2:64078855-64078877 TTGGAGTTTTATTTAATGTCAGG + Intergenic
931850396 2:66245978-66246000 TTGGAGTTTTATTTAATGTCGGG - Intergenic
931948227 2:67333625-67333647 TTGGAGTTTTATTTAATGTCAGG - Intergenic
932295825 2:70622677-70622699 TTGGAGTTTTATTTAATGTCGGG - Intronic
932358844 2:71088704-71088726 TTGGAGTTTTATTTAATGTCAGG + Intergenic
932854238 2:75217453-75217475 TTGGAGTTTTATTTAATGTCGGG + Intergenic
932973981 2:76577514-76577536 TTGGAGTTTTATTTAATGTTGGG + Intergenic
932998666 2:76891696-76891718 TTGGAGTTTATTCTAATGTGAGG - Intronic
933013061 2:77090426-77090448 TTGGAGTTTTATTTAATGTCGGG - Intronic
933079243 2:77967159-77967181 TTGGAGTTTTATTTAATGTCGGG - Intergenic
933137906 2:78759921-78759943 TTGGAGCTTTTTCTAATGTCAGG - Intergenic
933163703 2:79053437-79053459 TTGGAGTTTTATTTAATGTCAGG - Intergenic
933179798 2:79215506-79215528 TTGGAGTTTTATTTAATGTCAGG + Intronic
933329548 2:80878127-80878149 TTGGAGTTTTATTTAATGTCGGG + Intergenic
933552423 2:83792570-83792592 TTGGAGTTTTATTTAATGTCGGG + Intergenic
934057570 2:88264729-88264751 TTTGAGCTTTCTCTAATGTTTGG - Intergenic
934868556 2:97838114-97838136 TTTGAGTTGTTTCCAATGTCTGG + Intronic
936794322 2:116187925-116187947 TTGGAGCTTTATTTAAAGTCGGG + Intergenic
936813117 2:116426590-116426612 TTGGAGATTTTTAAAATGTTAGG + Intergenic
936883305 2:117280791-117280813 TTGGAGTTTTATTTAATGTCGGG - Intergenic
939083168 2:137686630-137686652 TTGGAGTTTTATTTAATGTCAGG + Intergenic
939307379 2:140428162-140428184 TTGGAGTTTTATTTAATGTTGGG - Intronic
939460762 2:142493520-142493542 TTGGAGTTTTATTTAATGTCAGG + Intergenic
939672223 2:145026530-145026552 GTGGAAATTTTTCAAATGTCAGG - Intergenic
940107315 2:150114629-150114651 TTGGAGTTTTATTTAATGTCAGG - Intergenic
940182913 2:150955089-150955111 TTGGAGCTTTTTTTAATGTCGGG - Intergenic
940183655 2:150960335-150960357 TTGAAGATTTTTCTAATGTCAGG - Intergenic
940216788 2:151310861-151310883 TGGGAGCTTTAGTTAATGTCGGG - Intergenic
940233908 2:151489017-151489039 TTGCAGCTTTTTCAAATTTTAGG + Intronic
940485948 2:154295667-154295689 TTAGAGCTTTCTCTAATGGCTGG - Intronic
940508823 2:154586923-154586945 TTGGAGTTTTATTTAATGTCAGG + Intergenic
940530162 2:154869371-154869393 TTGGAGTTTCATTTAATGTCGGG - Intergenic
940642341 2:156359165-156359187 TTGGAGCTATTTCTACTTTATGG - Intergenic
940665566 2:156604744-156604766 TTGTGGCTTTTTTTCATGTCTGG - Intronic
940675833 2:156723729-156723751 TTGGAGTTTTATTTAATGTCGGG + Intergenic
940726468 2:157341794-157341816 TTGGAGTTTTTTCTAACGTTGGG + Intergenic
940916891 2:159265971-159265993 TTGAAGATCTTTTTAATGTCTGG - Intronic
941047807 2:160696103-160696125 TTGCTGCTTTTTCCATTGTCTGG + Intergenic
941340372 2:164297903-164297925 TTGGAGTTTTATTTAAGGTCTGG - Intergenic
941456213 2:165714156-165714178 TTGGAGTTTTATTTAATGTCGGG + Intergenic
941540327 2:166774181-166774203 TTGAATTTTTTTCTAATTTCAGG + Intergenic
941935921 2:170981321-170981343 TTGGAGTTTTATTTAATGTCAGG + Intergenic
942097054 2:172543762-172543784 TTGGAGTTTTATTTAATGTCGGG - Intergenic
942443171 2:176057088-176057110 TTTAAGCTGTTTCTAATTTCTGG + Intergenic
942730323 2:179055436-179055458 TTGGAGTTTTATTTAATGTCGGG + Intergenic
943412959 2:187564139-187564161 TTGGAGTTTTATTTAATGTCGGG + Intronic
943421611 2:187674136-187674158 TTGGAGTTTTATTTAATGTCAGG + Intergenic
943450103 2:188035266-188035288 TTGGAGTTTTATTTAATGTCAGG - Intergenic
943461224 2:188172891-188172913 TTGGAGTTTTATTTAATGTCGGG + Intergenic
943596680 2:189866247-189866269 TTTGAGCTTTTTCAAATGATAGG + Intronic
943806622 2:192132470-192132492 TTGGAGTTTTATTTAATGTCAGG - Intronic
943835373 2:192509509-192509531 TTGGAGTTTTATTTAATGTCAGG - Intergenic
943865317 2:192920083-192920105 TTGGAGCTTTATTTAATGTGAGG - Intergenic
943951322 2:194134570-194134592 TTGGAGCTTTATTTAATGTCGGG + Intergenic
944387422 2:199181422-199181444 TTGGAGTTTTATTTAATGTCGGG - Intergenic
944394109 2:199248975-199248997 TTGGAGTTTTATTTAATGTCGGG - Intergenic
945173423 2:207019265-207019287 TTGGAGTTTTATTTAATGTTGGG - Intergenic
945211820 2:207391155-207391177 TTACAGTTTTTTCTAAAGTCTGG - Intergenic
945376076 2:209080121-209080143 TTGGAGTTTTATTTAATGTCAGG - Intergenic
945394274 2:209301274-209301296 TTGGAGTTTTATTTAATGTCGGG - Intergenic
945938287 2:215924421-215924443 TTGGAGTTTTATTTAATGTCGGG - Intergenic
946215060 2:218177692-218177714 TTGGAGTTTTATTTAATGTCAGG + Intergenic
946781075 2:223193528-223193550 TTGGAATTTTATTTAATGTCGGG + Intronic
946871789 2:224091537-224091559 TTGGAGTTTTATTTAATGTCGGG + Intergenic
946886470 2:224227340-224227362 TTGGAGTTTTATTTAATGTCGGG - Intergenic
946893245 2:224298725-224298747 TTGGAGTTTTATTTAATGTCGGG - Intergenic
947558014 2:231115261-231115283 TAGGAGATTTTTTTAAAGTCAGG + Intronic
948003347 2:234587018-234587040 TTCCAGGTTTTTCTAATTTCTGG - Intergenic
948341008 2:237251880-237251902 TTTGAGCATTTTCTTATTTCTGG - Intergenic
948390655 2:237609005-237609027 TTGGAGTTTTATTTAATGTTGGG - Intergenic
948959803 2:241324704-241324726 TTGGAGCTTTCTCTTTTTTCAGG + Intronic
1168737500 20:154773-154795 TTTGTTCTCTTTCTAATGTCTGG + Intergenic
1168739316 20:174542-174564 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1168839237 20:898568-898590 TTGGAGCTTTTTCTAATGTTGGG - Intronic
1168943305 20:1731404-1731426 TTGAAGTTTTTTTTAATGTCAGG + Intergenic
1169712427 20:8579985-8580007 TAGGAGCTCTCTCTATTGTCTGG + Intronic
1169978224 20:11354393-11354415 TTGGGGTCTTTTCTAATGCCTGG - Intergenic
1170068893 20:12343936-12343958 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1170106206 20:12755922-12755944 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1170325518 20:15151521-15151543 TTGGAGTTTTATTTAATGTCGGG + Intronic
1170680464 20:18521284-18521306 TTGGAGCTTTTTCTAATGTCAGG + Intronic
1170820730 20:19754806-19754828 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1173101882 20:40095391-40095413 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1173118844 20:40271107-40271129 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1173763808 20:45587884-45587906 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1176961161 21:15160679-15160701 TTAGATCTTTTGCTGATGTCTGG + Intergenic
1177031205 21:15983477-15983499 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1177063043 21:16397022-16397044 TTGGAGCTTTTTCTAGTATCAGG + Intergenic
1177083672 21:16674967-16674989 TTTGAAATTTTTCTAATGCCAGG - Intergenic
1177100592 21:16894204-16894226 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1177119535 21:17123517-17123539 TTGGAGCTTTATTTCATGTCAGG - Intergenic
1177589087 21:23138647-23138669 TTGGAGATAATTCTAATGACAGG + Intergenic
1177840775 21:26231727-26231749 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1178001171 21:28163238-28163260 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1178687953 21:34726160-34726182 TTCTAGCTCTGTCTAATGTCTGG + Intergenic
1178769229 21:35487210-35487232 TTGGAGCTTTTGCTAATTTCAGG + Intronic
1179015314 21:37590698-37590720 TTGGAGCTTTATTTAAAGTCGGG + Intergenic
1179387526 21:40957000-40957022 CTGGAGTTTTATTTAATGTCGGG - Intergenic
1179650397 21:42804710-42804732 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1180666563 22:17517590-17517612 TTGGGTCTTTTTCTAATGGCCGG + Intronic
1182254257 22:29026866-29026888 ATTGAGCTTTTTGTGATGTCTGG - Intronic
1182732247 22:32504839-32504861 TTGGAGTTTTATTTAATGTTGGG - Intergenic
1182998578 22:34836364-34836386 TTGGAGCTTTATATAAAGTTGGG - Intergenic
1183635696 22:39061175-39061197 TTGGAGCTTTTTCTAATGTCAGG + Intronic
949162126 3:894329-894351 TTGGAGTTTTATTTAATGTCGGG + Intergenic
949190426 3:1243472-1243494 TTGGAGTTTTATTTAATGTCGGG + Intronic
949671122 3:6399703-6399725 TTGGAGTTTTATTTAATGTCGGG - Intergenic
949827412 3:8179066-8179088 TTGGAGTTTTATTTAATGTAGGG - Intergenic
950236927 3:11330531-11330553 TTGGAGCATCTTATAATATCAGG - Intronic
951298841 3:20971172-20971194 TTGGAGTTTTATTTAATGTCGGG + Intergenic
951316349 3:21192886-21192908 TTGGAGTTTTATTTAATGTCGGG + Intergenic
951332355 3:21382218-21382240 TTGGAGTTTCATTTAATGTCGGG + Intergenic
951762827 3:26164056-26164078 TTGGAGTTTTATTTAATGTCGGG + Intergenic
951889010 3:27551814-27551836 TTGGAGGTTTATTTAATGTTGGG + Intergenic
952343590 3:32465097-32465119 TTGGAGCTTTATTTAATGTTGGG + Intronic
952663486 3:35878006-35878028 TTGGAGTTTTATTTAATGTCAGG + Intergenic
952896084 3:38079940-38079962 TTGGAGTTGTATTTAATGTCAGG + Intronic
953077162 3:39581460-39581482 TTGGAGTTTTATTTAATGTCAGG + Intergenic
953177166 3:40563041-40563063 TTGGAGTTTTATTTAATGTCGGG - Intronic
953599468 3:44348683-44348705 TTGGAGCTTTTTCTAATGTCGGG + Intronic
953825733 3:46249954-46249976 TTGGAGTTTTATTTAATGTCGGG + Intronic
953841195 3:46391424-46391446 TTGGAGCTTTTTCTAATGTCAGG + Intergenic
954504070 3:51051798-51051820 AGGGAGCTTTTACTCATGTCAGG + Intronic
954969295 3:54638143-54638165 TTGGAGTTTTATTTAATGTCGGG + Intronic
955122362 3:56073439-56073461 TGGGAACATTTGCTAATGTCTGG - Intronic
955651267 3:61196749-61196771 CTACAGCTTTTTCTACTGTCTGG - Intronic
956233528 3:67042367-67042389 TTGGAGCTTTATTTAATGTCGGG + Intergenic
956495992 3:69826477-69826499 TTGGAGCCTTTTCTAATTTGGGG + Intronic
956549020 3:70438550-70438572 TTGGAGTTTCATTTAATGTCCGG + Intergenic
956709187 3:72025011-72025033 TTGGAGTTTTATTTAATGTCGGG - Intergenic
957317342 3:78586807-78586829 TTGGAGTTTTATTTAATGTTGGG + Intergenic
957394339 3:79619837-79619859 TTGGACCTTTTTCTTACATCAGG - Intronic
957451413 3:80386928-80386950 TTGGAACTTTATTTAATGTTGGG - Intergenic
957734891 3:84191489-84191511 TTGGAGCTTTATTTAATGTTGGG + Intergenic
957904878 3:86542109-86542131 TTGGAGTTTTATTTAATGTCGGG + Intergenic
957985663 3:87571400-87571422 TTGGAGCTTTATTTAATATCGGG - Intergenic
958421924 3:93939822-93939844 TTGGAGCTTTTTCTAATGTCGGG - Intronic
958452163 3:94287074-94287096 TGGGATCTTCTTCTAATGTAAGG - Intergenic
958588203 3:96118344-96118366 TTGCAGCTTTTTCTAGTGCACGG - Intergenic
958750976 3:98193022-98193044 TTGGAGTTTTATTTAATGTCAGG - Intronic
959288381 3:104443579-104443601 TTGGAGTTTTATTTAATGTCAGG + Intergenic
959390577 3:105768303-105768325 TTGAAGATTTTTATAATCTCTGG - Intronic
959485800 3:106926390-106926412 TTGGAGTTTTATTTAATGTCGGG + Intergenic
959543727 3:107570329-107570351 TTGGAGCTTTTTCTAATGTCGGG + Intronic
959768759 3:110067848-110067870 GTGGAGCTTTTTCTGATATTTGG + Intergenic
960282907 3:115797166-115797188 TTGGAGTTTCATTTAATGTCGGG + Intergenic
960310146 3:116108979-116109001 TTGGAGTTTTATTTAATGTCGGG + Intronic
961164792 3:124756213-124756235 TTGGAGTTTTATTTAATGTTGGG + Intergenic
961711654 3:128832848-128832870 TTGGAGTTTTATTTAATGTCAGG + Intergenic
961730555 3:128961755-128961777 TTGGAGTTTTATTTAATGTCGGG - Intronic
961881021 3:130061322-130061344 TTGGAGTTTTATTTAATGTCGGG - Intergenic
961893744 3:130150827-130150849 TTGGAGTTCTATTTAATGTCGGG + Intergenic
962022210 3:131512764-131512786 TTGGAGCTTTATTTAATGTCAGG + Intergenic
962128368 3:132646671-132646693 TTTGAGCTGTTTCTAATTTTTGG - Intronic
962205536 3:133431178-133431200 TTGGAGTTTTATTTAATGTCAGG - Intronic
962660598 3:137597496-137597518 TTGGAGTTTTATTTAATGTTGGG - Intergenic
963387351 3:144614307-144614329 TTAGACCTTTATCTAATGTATGG + Intergenic
963425187 3:145115003-145115025 TTGTAGTTTTATTTAATGTCAGG - Intergenic
963456691 3:145554836-145554858 TTGGAGTTTTATTTAATGTCAGG + Intergenic
963468584 3:145712421-145712443 TTGGAGTTTTATTTAATGTCAGG - Intergenic
963663311 3:148153700-148153722 TTGGAGTTTTATTTAATGTCGGG - Intergenic
963684302 3:148416397-148416419 TTGGAGTTTTATTTAATGTCGGG - Intergenic
964125485 3:153230377-153230399 TTGGAGTTTTATTTAATGTCAGG + Intergenic
964300289 3:155278869-155278891 TTGGAGCTTTATTTAATGTCGGG + Intergenic
964536025 3:157722701-157722723 TTTGAGATCTTTCTAATTTCTGG + Intergenic
964906542 3:161725522-161725544 TTGGAGTTTTATTTAATGTCAGG + Intergenic
964940986 3:162157826-162157848 TTGGAGCTTTATTTAATGTCAGG + Intergenic
964984901 3:162726206-162726228 TTGGAGTTTTATTTAATGTCGGG + Intergenic
965070300 3:163909592-163909614 TTGGAGCTTTATTTAAAGTCTGG - Intergenic
965105257 3:164345807-164345829 TTGGAGTTTTATTTAATGTCAGG + Intergenic
965262685 3:166504473-166504495 TTGGAGTTTTATTTAATATCGGG + Intergenic
965286762 3:166827764-166827786 TTGGAGTTTTATTTAATGTCAGG + Intergenic
965336296 3:167433237-167433259 TTGGAGTTTTATTTAATGTCGGG - Intergenic
965624913 3:170676205-170676227 TTGGAGTTTTATTTAATGTCAGG + Intronic
965640071 3:170821641-170821663 TTGGAGTTTTATTTAATGTCAGG + Intronic
965713378 3:171578463-171578485 TTGGAGTTTTATTTAATGTCAGG - Intergenic
965862004 3:173159596-173159618 TTGGAGCTTTATTTAATGTTGGG + Intergenic
966058118 3:175721537-175721559 TTGGAGGTTTTTCTAATTAGAGG + Intronic
966105115 3:176325285-176325307 TTGGAGTTTTATTTAATGTCGGG + Intergenic
966232879 3:177669500-177669522 TTGGAGTTTTATTTAATGTTGGG + Intergenic
966279269 3:178209554-178209576 TTGGAGTTTTATTTAATGTCGGG - Intergenic
966397619 3:179518884-179518906 TTGGAGCTTTATTTAATGTTGGG - Intergenic
967005396 3:185378211-185378233 TTGGAGCTTTATTTAATATCGGG + Intronic
967212198 3:187179190-187179212 TTGGAGTTTTATTTAATGTCGGG + Intronic
967244199 3:187469932-187469954 TTGGAGTTTTATTTAATGTCGGG + Intergenic
967496193 3:190146554-190146576 TTGGAGTTTTATTTAATGTTGGG - Intergenic
967561356 3:190922154-190922176 TTGGAGTTTTATTTAATGTCAGG - Intergenic
967624677 3:191670148-191670170 TTGGAGTTTTATTTAATGTCAGG + Intergenic
967658138 3:192074746-192074768 TTGGAGTTTTATTTAATGTCGGG + Intergenic
967740455 3:192997706-192997728 TTGGAGTTTTATTTAATGTCAGG - Intergenic
968413286 4:407201-407223 TTGAAGCTTTTTCTCATGTCAGG + Intergenic
968993355 4:3929426-3929448 TTGGAGTTTTATTTAATGTAGGG - Intergenic
969003842 4:4003904-4003926 TCAGAGCTTTATTTAATGTCGGG + Intergenic
969749024 4:9096281-9096303 TTGGAGTTTTATTTAATGTCGGG - Intergenic
969810086 4:9640921-9640943 TCAGAGCTTTATTTAATGTCGGG - Intergenic
969994563 4:11298569-11298591 TTTGAGCTTTTGGTAATTTCAGG - Intergenic
970029268 4:11657420-11657442 TTGGAGTTTTATTTAATGTCAGG + Intergenic
970256449 4:14174186-14174208 TTGGAGTTTTATTTAATGTCGGG + Intergenic
970854078 4:20633960-20633982 TTGGAGCTTTATTTAAAGTCGGG + Intergenic
971180530 4:24325259-24325281 TTGGAGTTTTATTTAATGTCGGG - Intergenic
971200110 4:24503057-24503079 TTGGAGTTTTATTTAATGTCGGG - Intergenic
972071167 4:35020474-35020496 TTGGAGCTTTTTCTAAAGTCGGG + Intergenic
973751093 4:54021827-54021849 CTGGAGCTTTTTTTAATGTTGGG - Intronic
974092582 4:57327545-57327567 TTGGCTTTTTTTCTAGTGTCAGG - Intergenic
974173459 4:58295009-58295031 TTGGAACTTTATTTAATGTTGGG + Intergenic
974428426 4:61767953-61767975 TTGGAGTTTTATTTAATGTCGGG + Intronic
974543475 4:63269625-63269647 TTGCAGCTTTTTCTAGATTCAGG + Intergenic
974903752 4:68032666-68032688 TTGGAGCTTTATTTAATGTTGGG - Intergenic
975037047 4:69696966-69696988 TTTGAGATCTTTCTAATTTCTGG + Intergenic
975865119 4:78717523-78717545 TTGGAGTTTTATTTAATGTTGGG + Intergenic
975933919 4:79557641-79557663 TTGGAGTTTTATTTAATGTTGGG + Intergenic
976558539 4:86476610-86476632 TTGGAGCTTTATTTCATGTCAGG - Intronic
976696505 4:87923914-87923936 TTGGAGTTTTATTTAATGTTGGG - Intergenic
976739986 4:88347412-88347434 TTGGAGCTTTATTTAATCTCAGG + Intergenic
976884601 4:89968457-89968479 TTGGAGTTTTATTTAATGTTGGG + Intergenic
977012955 4:91658287-91658309 TTGGAGTTTTATTTAATGTTGGG + Intergenic
977062538 4:92275156-92275178 TTGGAGTTTTATTTAATGTTGGG + Intergenic
977075238 4:92442626-92442648 TTGGAGTTTTATTTAATGTTGGG + Intronic
977198460 4:94088289-94088311 TTGGAGTTTTATTTAATGTCGGG + Intergenic
977217185 4:94296880-94296902 TTGGAGTTTTATTTAATGTCGGG + Intergenic
977225373 4:94387133-94387155 TTGGAGTTTTATTTAATGTTGGG + Intergenic
977907046 4:102489031-102489053 TTGGAGTTTTTTATAGTTTCTGG - Intergenic
978031449 4:103943160-103943182 TTGGAGTTTTATTTAATGTTGGG - Intergenic
978163108 4:105573114-105573136 TTGGAGCTCTTTCTACATTCTGG + Intronic
978303256 4:107294107-107294129 TTAGAGCTTTTTCTAATGTCGGG + Intergenic
978438581 4:108711073-108711095 TTGGAGTTTTATTTAATGTCGGG - Intergenic
979054651 4:115979318-115979340 TTGGAGTTTTATTTAATGTCGGG + Intergenic
979146589 4:117254146-117254168 TTGGAGTTTTATTTAATGTCGGG - Intergenic
979374185 4:119925515-119925537 TTGAAGCTGTTTTTACTGTCAGG + Intergenic
979379911 4:119995966-119995988 TTGGAGTTTTATTTAATGTCAGG - Intergenic
979850337 4:125565301-125565323 TTGGAGTTTTATTTAATGTCGGG + Intergenic
979895191 4:126148803-126148825 TTGGAGTTTTATTTAATGTCGGG + Intergenic
980003384 4:127515136-127515158 TTGGAGATTTATTTTATGTCAGG + Intergenic
980111960 4:128644500-128644522 TTGGAGTTTTATTTAATGTTGGG + Intergenic
980284916 4:130769379-130769401 TTGGAGTTTTATTTAATGTTGGG - Intergenic
980472472 4:133267384-133267406 TTGGAGTTTTATTTAATGTCGGG + Intergenic
980527837 4:134014190-134014212 TTGGAGTTTTATTTAATGTCGGG - Intergenic
980575667 4:134681571-134681593 TTGGAGTTTTATTTAATGTCGGG + Intergenic
980611807 4:135170957-135170979 TTGGAGTTTTATTTAATGTCAGG + Intergenic
980681226 4:136164140-136164162 ATGCAGATTTTTTTAATGTCTGG - Intergenic
980903908 4:138929917-138929939 TTGGAGTTTTATTTAATGTCAGG - Intergenic
981040214 4:140215540-140215562 TTGGAGTTTTATTTAATGTTGGG - Intergenic
981482755 4:145255210-145255232 TTGGAGCTTTTTCTAATGTCGGG + Intergenic
981598481 4:146455872-146455894 TTGGAGTTTTTTCTAATGTTAGG + Intronic
982083997 4:151816266-151816288 TTGGAGTTTTATTTAATGTCAGG + Intergenic
982318781 4:154058299-154058321 TTGGAGCTTTTTCTAATGTCAGG - Intergenic
982414228 4:155112126-155112148 TTGGAGTTTTATTTAATGTTGGG + Intergenic
982497137 4:156107131-156107153 TTGGAGTTTTATTTAATGTCGGG + Intergenic
982535415 4:156602328-156602350 TTGGAGTTTTATTTAATGTCGGG - Intergenic
982617369 4:157656420-157656442 TGGGTGCTTTTTATAGTGTCAGG - Intergenic
983023841 4:162711148-162711170 TTGGAGTTTTATTTAATGTTGGG - Intergenic
983055455 4:163095134-163095156 TTGGAGTTTTATTTAATGTCGGG - Intergenic
983345525 4:166522541-166522563 TTGGAGTTTTATTTAATGTTGGG - Intergenic
983360377 4:166718346-166718368 TTGGAGTTTTATTTAATGTCAGG - Intergenic
983414741 4:167439469-167439491 TTGGAGTTTTATTTAATGTCGGG + Intergenic
983448026 4:167878295-167878317 TTGGATTTTTATTTAATGTCAGG - Intergenic
983452308 4:167924940-167924962 TTGGAGTTTTATTTAATGTTGGG - Intergenic
983659543 4:170118501-170118523 TTGAAGTTTTATGTAATGTCGGG - Intergenic
983707640 4:170679511-170679533 TTGGAGTTTTATTTAATGTCAGG - Intergenic
983805818 4:171989722-171989744 TTGCAGTTTTATTTAATGTCAGG + Intronic
983883791 4:172960061-172960083 TTGGAGTTTTATTTAATGTCAGG + Intronic
983950149 4:173629828-173629850 TTTTAGCTTTCTGTAATGTCTGG + Intergenic
984165389 4:176298539-176298561 TTGGAGTTTTATTTAATGTCGGG + Intergenic
984322155 4:178209168-178209190 TTGGAGTTTTATTTAATGTCAGG - Intergenic
984393641 4:179168556-179168578 TTGGAGTTTTATTTAATGTCCGG + Intergenic
984411694 4:179405237-179405259 TTGGAGCTTTTTCTAATGTTGGG - Intergenic
984437229 4:179722465-179722487 TTGGAGTTTTATTTAATGTTGGG - Intergenic
984700641 4:182816566-182816588 TTGGAGTTTTATTTAATGTCCGG - Intergenic
984936929 4:184897821-184897843 TTGGAGCTCTTTCTTATAACAGG + Intergenic
985057430 4:186047889-186047911 TTGGAGTTTTATTTAATGTCAGG + Intergenic
985243323 4:187954322-187954344 TTGCAGCATATTCTAATCTCTGG + Intergenic
985389900 4:189483128-189483150 TTGGAGTTTTATTTAATGTCGGG + Intergenic
985435690 4:189927868-189927890 TAGGAGTTTTATTTAATGTCGGG - Intergenic
985582327 5:704836-704858 TTGGAGTTTTATTTAATGTTGGG - Intergenic
986193507 5:5517599-5517621 TTGGAGTTTTATTTAATGTCAGG - Intergenic
986369000 5:7061944-7061966 TTGGAGCTTTATTTAATGTCAGG + Intergenic
986388847 5:7265631-7265653 TTGGAGTTTTATTTAATGTCGGG - Intergenic
986555075 5:9002237-9002259 TTGGAGTTTGATTTAATGTCAGG + Intergenic
986905743 5:12491848-12491870 TTGGAGTTTTATTTAATGTCGGG - Intergenic
986919618 5:12666204-12666226 TTGGAGTTTTATTTAATGTCGGG + Intergenic
987282011 5:16422060-16422082 TTGGAGTTTTATTTAATGTCGGG - Intergenic
987486804 5:18535721-18535743 TTGGAGTTTTATTTAATGTCAGG - Intergenic
987487473 5:18540354-18540376 TTGGAGTTTTATTTAATGTCGGG - Intergenic
987493291 5:18609626-18609648 TTGGAGGTATTTCTAAAGTAAGG - Intergenic
987498155 5:18672523-18672545 TTGGAGTTTTATTTAATGTTGGG + Intergenic
987755799 5:22096868-22096890 TTGGAGCTTTATTTAATGTTGGG - Intronic
988199064 5:28047659-28047681 TTGGAGCTTTTTCTAATGTCGGG - Intergenic
989615181 5:43331632-43331654 TTGGAGCTTTTTCTAATGTCAGG + Intergenic
989659897 5:43788161-43788183 TTGGAGCTTTTTCTAATGTTGGG - Intergenic
989688928 5:44118399-44118421 TTGGAGCTTTTTGTAATGTCGGG + Intergenic
989717537 5:44481976-44481998 TTTGAGCTTTGCCTAATGCCTGG - Intergenic
989780924 5:45263629-45263651 TTGGATATTTTTCTTATCTCTGG + Intronic
990232709 5:53731469-53731491 TTGGAGCTTATTCTTGTGTATGG - Intergenic
990279435 5:54233883-54233905 TTGCAGATCTTTTTAATGTCTGG - Intronic
990565152 5:57020672-57020694 TTGGAGCTTTTTTTAATGTCGGG + Intergenic
990771242 5:59248347-59248369 ATGGAGCTTTTCCTAGTGCCTGG + Intronic
990776773 5:59312663-59312685 TTGTAAATTTTCCTAATGTCTGG - Intronic
992362757 5:76058104-76058126 TTTGAGCTGTGTCTTATGTCTGG + Intergenic
992394631 5:76359398-76359420 TTGGAGTTTTATTTAATGTCGGG - Intergenic
992452036 5:76884072-76884094 TTGGAGCTTTATTTAATGTTGGG + Intronic
992586562 5:78245868-78245890 CTGCAGCTTTTTCAAATATCAGG - Intronic
992960799 5:81955304-81955326 TTGGAGTTTTATTTAATGTCAGG - Intergenic
993192684 5:84700525-84700547 TTGGAGTTTTATTTAATGTCGGG - Intergenic
993836675 5:92826021-92826043 TTGGAGTTTTATTTAATGTCGGG - Intergenic
994126139 5:96170564-96170586 TTGGAGCTTTATTTAATGTCGGG + Intergenic
994295114 5:98081084-98081106 TTGGAGTTTTATTTAATGTCGGG - Intergenic
994324846 5:98436587-98436609 TTGGAGCTTTTTCTAATGTCAGG - Intergenic
994375819 5:99014999-99015021 TTGGAGCTTTTTCTAATGTCGGG + Intergenic
994532573 5:100987918-100987940 TTGGAGTTTTATTTAATGTCGGG + Intergenic
994556900 5:101316956-101316978 TTGGAGTTTTATTTAATGTCGGG - Intergenic
994775655 5:104033663-104033685 TTGGAGTTTTATTTAATGTCGGG - Intergenic
994989516 5:106980426-106980448 TTGGAGTTTTATTTAATGTCGGG - Intergenic
995296649 5:110531887-110531909 TTGGAGTTTTATTTAATGTTGGG - Intronic
995769349 5:115652547-115652569 TTGGAGCTTTTTCTAATGTCGGG - Intergenic
995788754 5:115860566-115860588 TTGGTGCTTTTACATATGTCTGG - Intronic
995899397 5:117050030-117050052 TTGTAGTTTTATTTAATGTCGGG + Intergenic
996203289 5:120701255-120701277 TTGGAGTTTTATTTAATGTCGGG + Intergenic
996344854 5:122477269-122477291 TTGGAGTTTTATTTAATGTCGGG + Intergenic
996358658 5:122622558-122622580 TTGGAGCTTTATTTAATGTTGGG + Intergenic
996509873 5:124305821-124305843 TTGGAGCTTTATTTAATGTTGGG - Intergenic
996528024 5:124499074-124499096 TTGGAGTTTTATTTAATGTCGGG - Intergenic
996575034 5:124970287-124970309 TTGGAGCTTTATTTAATGTTGGG + Intergenic
996745477 5:126843223-126843245 TTGGAGTTTTATTTAATGTCGGG + Intergenic
996858654 5:128040081-128040103 TTTGAGCATTTACTAATGTATGG + Intergenic
997597728 5:135118264-135118286 TTTGAGCATTTTCTAATTTGAGG + Intronic
997746369 5:136303332-136303354 TTGGAGTTTTATTTAATGTCAGG - Intronic
997769709 5:136543277-136543299 TTGGAGTTTTATTTAATGTCAGG + Intergenic
997772675 5:136569012-136569034 TTGGAGTTTTATTTAATGTCAGG + Intergenic
998693735 5:144615029-144615051 TTGGAGAATTATTTAATGTCGGG + Intergenic
998995358 5:147865321-147865343 TTGGAGTTTTATTTAATGTCGGG - Intergenic
998996428 5:147872637-147872659 TTGGAGTTTTATTTAATGTCGGG + Intronic
999618898 5:153453374-153453396 TTGGAGTTTTATTTAATGTCAGG + Intergenic
999953085 5:156671226-156671248 TTGGAGCTTTATCAAATGGTTGG + Intronic
1000439690 5:161250512-161250534 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1000519440 5:162279041-162279063 TTGGAGTTTTATTTAATGTAGGG + Intergenic
1000606901 5:163336066-163336088 TTGGAGCTTTTTGTAATGTCAGG - Intergenic
1000710194 5:164565214-164565236 ATTGAGCTTTTTCTTGTGTCTGG + Intergenic
1000885356 5:166742776-166742798 TTGGAGTTTTATTTCATGTCAGG + Intergenic
1000935676 5:167301579-167301601 TTGGAGTTTTATTTAATGTTGGG + Intronic
1001331482 5:170765698-170765720 TTGGAGTTTTATTTAATGTAGGG + Intronic
1002610995 5:180418390-180418412 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1003430199 6:6031447-6031469 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1004106234 6:12669423-12669445 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1004283554 6:14300615-14300637 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1004508027 6:16262657-16262679 TTGGAGTTTTCTTTAATGTCGGG + Intronic
1004612594 6:17258385-17258407 TTGGATATTTTTCTAATCTTTGG - Intergenic
1004768607 6:18757730-18757752 TTGGAGTTTTATTTAATGTTGGG + Intergenic
1004836967 6:19540923-19540945 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1005014689 6:21365172-21365194 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1005258089 6:24026095-24026117 TTGGAGCTTATTCTTTTGTATGG - Intergenic
1005786609 6:29250897-29250919 TTGGAGCTTTTTCTAATGTTGGG + Intergenic
1008476493 6:51940203-51940225 TTGTAGTTTTATTTAATGTCAGG - Intronic
1008844592 6:55948254-55948276 TTGGAGTTTATTCTTATGTGTGG - Intergenic
1008850247 6:56014479-56014501 TTGGAGCTTTATTTAAAGTCGGG + Intergenic
1009269787 6:61602121-61602143 TTGGAGCTTTGTTTAATATTGGG - Intergenic
1009343575 6:62587997-62588019 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1009359324 6:62793523-62793545 TTGTAGTTTTATTTAATGTCAGG - Intergenic
1009379113 6:63007334-63007356 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1009464309 6:63951952-63951974 TTGGAGCTTTATTTAATGTCGGG - Intronic
1009550813 6:65089247-65089269 TTGCAGCTTTTTCAAGTGTAAGG - Intronic
1009672610 6:66775572-66775594 TTTGAGATTTTTCTAATTTTTGG + Intergenic
1009750330 6:67872630-67872652 TTGGAGATTTATTTAATGTCGGG + Intergenic
1010071754 6:71752239-71752261 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1010285891 6:74077427-74077449 AGGGAGCTTTTACTCATGTCAGG - Intergenic
1010586728 6:77664220-77664242 TTGGAGTTTTATTTAATGTTGGG + Intergenic
1010826943 6:80486102-80486124 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1010829725 6:80513997-80514019 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1010841345 6:80651489-80651511 TTGGAGTTTTGTTTAATGTCTGG + Intergenic
1010894575 6:81348802-81348824 TTGGAGTTTTATTTAATTTCGGG + Intergenic
1011367926 6:86602028-86602050 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1011770975 6:90673877-90673899 TTGGAGTTTTATTTAATGTTGGG + Intergenic
1012014422 6:93833743-93833765 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1012066576 6:94557611-94557633 TTGGAGTTTTATTTAATGTTGGG + Intergenic
1012315792 6:97781642-97781664 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1012689545 6:102294971-102294993 TTGGAGTTTTATTTAATGTTGGG - Intergenic
1013407916 6:109859417-109859439 TTGGAGTTTTATTTAATGTAGGG + Intergenic
1013808116 6:114016004-114016026 TTGGAGCTTTTTCTAATGTTGGG + Intergenic
1013843711 6:114425989-114426011 TTGGAGTTTTATTTAATGTTGGG + Intergenic
1013891673 6:115033930-115033952 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1014115377 6:117663375-117663397 TTGGAGCTTTTTCTAACGTTGGG + Intergenic
1014360192 6:120465931-120465953 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1014396036 6:120927235-120927257 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1014454902 6:121624104-121624126 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1014612051 6:123558661-123558683 TTGGAGTCTTATTTAATGTCGGG - Intronic
1014614705 6:123585953-123585975 TTGGAGTTTTATTTAATGTCGGG + Intronic
1014718864 6:124894082-124894104 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1014794021 6:125705526-125705548 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1014891513 6:126850798-126850820 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1015141441 6:129938310-129938332 TTGGAGCATCTTGTAGTGTCAGG - Intergenic
1015165193 6:130194389-130194411 TTGGAGTTTTATTTAATGTCAGG - Intronic
1015269628 6:131325448-131325470 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1015271343 6:131340920-131340942 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1015278122 6:131404858-131404880 ATGGAGTTTTATTTAATGTCAGG - Intergenic
1015288067 6:131507946-131507968 TTGGAGTTTTATTTAATGTTGGG + Intergenic
1015801409 6:137065012-137065034 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1016114172 6:140261075-140261097 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1016248832 6:142017853-142017875 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1016518772 6:144925217-144925239 TTGGAGTTTTATTTAATGTTGGG - Intergenic
1016535788 6:145106814-145106836 TTGGACTTTTATTTAATGTCGGG + Intergenic
1016650324 6:146454080-146454102 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1016853237 6:148641840-148641862 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1017269784 6:152492232-152492254 TTGGAGCTTTTTCTAATGTTGGG - Intronic
1017350939 6:153441477-153441499 TTGTATCTTTTTATAAGGTCAGG + Intergenic
1017389467 6:153923530-153923552 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1017779364 6:157704338-157704360 TTGGAGTTTTATTTAATGTCAGG + Intronic
1017954005 6:159163122-159163144 ATGGTGCTTTTTCTTAAGTCAGG + Intergenic
1018084529 6:160290236-160290258 TTGGAGTTTTATTTAGTGTCGGG + Intergenic
1018495433 6:164342395-164342417 TTGGAGTTTTATTTAATGTTGGG + Intergenic
1018500986 6:164411137-164411159 TTGGGGTTTTGTCTAATCTCTGG + Intergenic
1018521503 6:164655816-164655838 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1019172980 6:170145035-170145057 TTGGTGCTTGTTCTGATGTTTGG + Intergenic
1020221352 7:6240667-6240689 TTGGAGTTTATTCTGATGTGTGG - Intronic
1020316021 7:6905835-6905857 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1020323976 7:6960359-6960381 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1020532746 7:9357084-9357106 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1020541173 7:9462220-9462242 TTGGAGCTTTATTTAAAGTCGGG + Intergenic
1020690173 7:11345075-11345097 TTTGATTATTTTCTAATGTCAGG + Intergenic
1020794181 7:12661602-12661624 CTGGAGCTTTTTTTAAAGTCAGG - Intergenic
1021172641 7:17415845-17415867 TTGGAGCTTTATTTAATGTCAGG - Intergenic
1021393590 7:20122621-20122643 TTGGAGCTTTATTTAATGTCAGG - Intergenic
1021429815 7:20547494-20547516 TTGGAGTTTTATTTAAAGTCGGG - Intergenic
1021517388 7:21503351-21503373 TTGGTGCTTGTTCTAATCTAAGG + Intronic
1021637285 7:22705289-22705311 TTGGAGATTTATTTAAAGTCGGG - Intergenic
1021810632 7:24398322-24398344 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1021977926 7:26027851-26027873 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1022372842 7:29786892-29786914 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1022447375 7:30481250-30481272 TTGGAGCTTTATGTAACGTCGGG - Intergenic
1022572824 7:31470718-31470740 TTGGAGTTTTATTTAATGTTAGG + Intergenic
1022597786 7:31729162-31729184 TTTGTGCTTTTTAAAATGTCAGG - Intergenic
1022709037 7:32834412-32834434 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1022710077 7:32841568-32841590 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1022854740 7:34303557-34303579 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1023698918 7:42874272-42874294 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1024697591 7:51872063-51872085 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1026588049 7:71673560-71673582 TTCCAGCTTTCACTAATGTCAGG + Intronic
1027157852 7:75781171-75781193 TTGGAGTTTTATTTAATGTCGGG - Intronic
1027158283 7:75783949-75783971 TTGGAGCTTTATTTAATGTCAGG - Intronic
1027258487 7:76446467-76446489 TTCCAGTTTTCTCTAATGTCTGG - Intergenic
1027280361 7:76605551-76605573 TTCCAGTTTTCTCTAATGTCTGG + Intergenic
1027354390 7:77341717-77341739 TTGGAGCTTTATTTAATGTCGGG - Intronic
1027851913 7:83461713-83461735 TTGGAGTTTTATTTAATGTCGGG - Intronic
1028589940 7:92483477-92483499 TTGGAGCTTTATTTAATGTTGGG + Intergenic
1028670480 7:93395977-93395999 TTGGAGTTTCATTTAATGTCAGG - Intergenic
1028690147 7:93641906-93641928 TTGGAGTTTCATTTAATGTCGGG - Intronic
1029100264 7:98124094-98124116 TAAGAGGTTTTTCAAATGTCAGG + Intronic
1029500181 7:100924189-100924211 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1030163642 7:106532092-106532114 TTGGAGCTTTTTCTAATGCCGGG + Intergenic
1030441719 7:109595719-109595741 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1030445804 7:109645779-109645801 TTGGAGCTTTATTTAATGTTGGG + Intergenic
1030751531 7:113237243-113237265 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1031004639 7:116457529-116457551 TTGGAGTTTTATTTAATATCTGG - Intronic
1031296583 7:120010910-120010932 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1031355224 7:120780808-120780830 TTGGAGCTTTATTTAAAGTCAGG + Intergenic
1031364777 7:120889303-120889325 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1031399953 7:121317617-121317639 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1031422486 7:121567671-121567693 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1031525562 7:122818966-122818988 TTGGAGTTTTATTTAATGTCGGG - Intronic
1031685814 7:124731085-124731107 TTGGAGTTTTATTTAATGTTGGG - Intergenic
1031727963 7:125262567-125262589 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1031776293 7:125912034-125912056 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1031777312 7:125919633-125919655 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1031952993 7:127911307-127911329 TTGAAGTTTTTTCCAAAGTCTGG - Intronic
1032017483 7:128389218-128389240 TTGGAGCTTTTTATTCTTTCAGG - Intergenic
1033084686 7:138331047-138331069 TTGGAGCTTTATTTAATGTCGGG - Intergenic
1033211489 7:139463295-139463317 TTGGAGCTTTATTTAATGTCAGG - Intronic
1033465067 7:141582477-141582499 TTGGAGTTTTATTTAATGTTGGG + Intronic
1033625556 7:143106869-143106891 TTGGAGCTTTTTCTAATGTCGGG - Intergenic
1033675982 7:143540887-143540909 TTGGAGTTTTATTTGATGTCGGG + Intergenic
1033695853 7:143788552-143788574 TTGGAGTTTTATTTGATGTCGGG - Intergenic
1033909496 7:146247044-146247066 TTGGAGTTGTATTTAATGTCGGG + Intronic
1035880696 8:3241908-3241930 TTGGAGTTTTATTTAATGCCGGG + Intronic
1036070958 8:5440328-5440350 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1036281451 8:7404483-7404505 TTGGAGTTTTATTTAATGTTGGG - Intergenic
1036340018 8:7907089-7907111 TTGGAGTTTTATTTAATGTTGGG + Intergenic
1036372099 8:8170626-8170648 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1036626946 8:10480064-10480086 TTGGAGCATTTTCTACTTGCTGG + Intergenic
1036878802 8:12495015-12495037 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1038389501 8:27181825-27181847 TTGCAAATCTTTCTAATGTCTGG + Intergenic
1039499024 8:38002369-38002391 TTGGAGCTTTTCCTAATTTTGGG + Intergenic
1040647996 8:49421518-49421540 CTGGAGCTTTATTTAATGTCAGG - Intergenic
1041651869 8:60310192-60310214 TTGGAGCTTTATTTAATGTCAGG + Intergenic
1041917569 8:63151988-63152010 TTGGAGCTTTTTCTAATGTCGGG + Intergenic
1042453525 8:68975217-68975239 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1042707337 8:71676957-71676979 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1043543806 8:81292946-81292968 TTGGAGCTTTTTGTATTTTGGGG + Intergenic
1043597483 8:81902201-81902223 TTTGAGCTTTATTTAATGTTGGG + Intergenic
1043717924 8:83508806-83508828 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1043720876 8:83545988-83546010 TTGGAGCTTTTTCTAATGTCGGG - Intergenic
1043837702 8:85064992-85065014 TTGGAGCTTTATTTCATGTCGGG - Intergenic
1044148543 8:88745880-88745902 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1044258646 8:90093871-90093893 TTGGAGTTTTATTTAATGTCAGG + Intronic
1044417051 8:91950014-91950036 TTGGAGTTTTATTTAATGTGGGG - Intergenic
1044804261 8:95988910-95988932 TTTGAGCTTTTTCAAGTGTAGGG - Intergenic
1045197490 8:99945915-99945937 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1045644750 8:104287979-104288001 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1046294089 8:112197868-112197890 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1046386375 8:113513178-113513200 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1046439981 8:114243382-114243404 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1046443216 8:114284037-114284059 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1046555855 8:115772382-115772404 TTGGAGCCCTTTCTCATCTCTGG + Intronic
1046559251 8:115816653-115816675 TTGGAGTTTTATTTAATGTTGGG - Intergenic
1047699315 8:127433773-127433795 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1047829572 8:128615573-128615595 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1047856338 8:128916437-128916459 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1048097580 8:131312226-131312248 TTGGAGCTTTATTTAATGTCGGG - Intergenic
1048135436 8:131742744-131742766 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1048143738 8:131821206-131821228 TTGGAGCTTTATTTCATGTCGGG - Intergenic
1048168467 8:132083902-132083924 TTGGAGTTTTATTTAATGTCGGG + Intronic
1048202521 8:132387249-132387271 TTGGAAACTTTTCTAATGTTGGG - Intronic
1048585452 8:135770812-135770834 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1048728456 8:137411967-137411989 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1048764267 8:137828510-137828532 TTGGAGTTTTATTTAATGTTGGG + Intergenic
1049868850 8:144957950-144957972 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1050140447 9:2511453-2511475 TTGGAGGTTTTTCTAATGTTGGG - Intergenic
1050258140 9:3814843-3814865 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1050474137 9:6022022-6022044 TCAGAGCTTTATTTAATGTCGGG - Intergenic
1050628516 9:7534265-7534287 TTGGAGCTGTTTCTATGGTAGGG + Intergenic
1050658391 9:7854697-7854719 TTAGTGATTTTTCCAATGTCAGG - Intronic
1051052594 9:12950366-12950388 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1051849317 9:21489366-21489388 TTGGAGTTTTATTTAATGTTGGG + Intergenic
1051953438 9:22662213-22662235 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1052163049 9:25289718-25289740 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1052191802 9:25670946-25670968 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1052360409 9:27549931-27549953 TAGGTGCTTTTTGTAGTGTCTGG - Intronic
1053057993 9:35005507-35005529 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1053059947 9:35022969-35022991 TTGGAGCTTTTTCTAATGTCGGG + Intergenic
1053078489 9:35154897-35154919 TTGGAGCTTTTTCTAATGTCGGG + Intergenic
1053171957 9:35893983-35894005 CAGGAGCTTTTTCAAATTTCAGG + Intergenic
1054807521 9:69408444-69408466 TTGGAGTTTCATTTAATGTCGGG + Intergenic
1055233029 9:74087709-74087731 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1055347753 9:75355472-75355494 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1055626691 9:78182828-78182850 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1055810014 9:80139455-80139477 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1055881716 9:81011026-81011048 TTGGAGTTTCATTTAATGTCAGG - Intergenic
1056044769 9:82704376-82704398 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1056061129 9:82885803-82885825 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1056323853 9:85460692-85460714 TTGGAGTTTTATTTAATGTTGGG - Intergenic
1056363676 9:85882709-85882731 CTGGAGCTTTTTTTAATGTCGGG - Intergenic
1056522415 9:87412972-87412994 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1056882949 9:90414621-90414643 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1057234813 9:93349651-93349673 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1057377961 9:94541873-94541895 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1057683968 9:97216889-97216911 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1057812612 9:98269502-98269524 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1058026236 9:100144358-100144380 TTGGAGCTTTATTTAAAGTCAGG + Intronic
1058503384 9:105645676-105645698 CTGGAGCTTTTTCTAGACTCGGG - Intergenic
1058612367 9:106790216-106790238 TTGGAGTTTTATTTAATGTTGGG - Intergenic
1059546193 9:115178311-115178333 TTGGAGTTTTATTTAATGTCGGG + Intronic
1059574591 9:115475405-115475427 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1059606738 9:115842869-115842891 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1060287883 9:122270514-122270536 TTTGTGCTTTTTCTCATGTAAGG + Intronic
1060318503 9:122534279-122534301 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1060737917 9:126078319-126078341 TTGGAGTTTTATTTAATGTTGGG + Intergenic
1185858462 X:3556790-3556812 TGGGAGTTTTATTTAATGTCGGG + Intergenic
1185960717 X:4544152-4544174 TTGGAGTTTTATTTAATATCGGG + Intergenic
1185991028 X:4893636-4893658 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1186112898 X:6275839-6275861 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1186784037 X:12941847-12941869 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1186902974 X:14077993-14078015 TTGGAGTTTACTCTAATTTCTGG + Intergenic
1187086555 X:16048351-16048373 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1187099990 X:16182842-16182864 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1187103796 X:16220484-16220506 TTGGAGCTTTTTCTAATGTCGGG + Intergenic
1188301084 X:28506088-28506110 TTGGAGCTTTATTTAATGTCGGG + Intergenic
1188333054 X:28896280-28896302 TTGGAGTTTTATTTAATGTCAGG + Intronic
1188430989 X:30105363-30105385 TTGGAGTTTTATTAAATGTCGGG - Intergenic
1188824361 X:34812075-34812097 TTTGAGCTATTTCTAATTTTTGG + Intergenic
1189622126 X:42852946-42852968 TCTGAGCTTGTTCTATTGTCTGG + Intergenic
1191014227 X:55791969-55791991 TTGGAGCTTTTTCTAATGTCGGG + Intergenic
1191740036 X:64426596-64426618 TAGGAGATTTGTCAAATGTCAGG - Intergenic
1191805840 X:65133324-65133346 TTGGAGCTTTTTCTAATGTCGGG + Intergenic
1191825522 X:65361737-65361759 TTGGAGCTTTTTTTAATGTTGGG - Intergenic
1192454568 X:71266229-71266251 TTGGAGCTTTTTCTAATGTTGGG - Intergenic
1192731546 X:73806574-73806596 TTGGAGCTTTTTCTAATGTCAGG + Intergenic
1193102511 X:77631154-77631176 TGGGAGCTTTTTTTAAGGTGAGG - Intronic
1193153201 X:78146067-78146089 TTTGAGCTTCTTATATTGTCTGG + Intergenic
1193431224 X:81408341-81408363 TTAGATATTTTTCTAATTTCCGG - Intergenic
1193885901 X:86983852-86983874 TTGGAGTTTTATTTAATGTTGGG - Intergenic
1193941466 X:87683936-87683958 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1194186279 X:90776983-90777005 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1194293655 X:92103899-92103921 TTGGAGTTTTATTTAATGTCGGG + Intronic
1194308569 X:92276726-92276748 TTGGAGTTTTATTTAATGTCGGG + Intronic
1194351260 X:92826541-92826563 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1194367076 X:93024980-93025002 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1194501940 X:94692087-94692109 TAGGAGATTTGTCTAAAGTCAGG + Intergenic
1194503011 X:94702482-94702504 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1194822800 X:98527937-98527959 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1194873829 X:99163100-99163122 TTGGAGCTTTATTTAAAGTCAGG + Intergenic
1195016984 X:100790110-100790132 TTGGAGCTTTTTCTAATGTCAGG + Intergenic
1195291191 X:103433219-103433241 TTAGAGTTTTATTTAATGTCGGG + Intergenic
1195326894 X:103765465-103765487 TTGGAGTTTTATTTAATGTTGGG + Intergenic
1195841453 X:109180448-109180470 TTGGAGCTTTATTTAATGTCGGG - Intergenic
1195908709 X:109868878-109868900 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1195971279 X:110476278-110476300 TTTGAGCTGTTACTAATGTGTGG + Intergenic
1196073053 X:111545964-111545986 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1196165515 X:112532663-112532685 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1196182994 X:112715458-112715480 TAGGGGCTTTTTCTACAGTCTGG + Intergenic
1196221016 X:113112380-113112402 TTGGAGCTTTATTTCATGTTGGG + Intergenic
1196299981 X:114042030-114042052 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1196330792 X:114468810-114468832 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1196341747 X:114604965-114604987 TTGGAGTTTTATTTAATGTCAGG + Intronic
1196496831 X:116332843-116332865 TTGGAGCTTTATTTAATGTTGGG - Intergenic
1196525509 X:116724642-116724664 TTGGAGCTTTATTGAATGTCGGG + Intergenic
1196533569 X:116816127-116816149 TTGGAGATTTATTTAATGTGGGG + Intergenic
1196572471 X:117281206-117281228 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1196585093 X:117419684-117419706 CTGGAGCTTTTTTTAATGTTGGG - Intergenic
1196773883 X:119321429-119321451 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1196992716 X:121346674-121346696 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1197042597 X:121957608-121957630 TAGGAGATTTGTCAAATGTCAGG - Intergenic
1197064885 X:122224082-122224104 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1197352091 X:125392508-125392530 TTGGAGTTTTATTTAATGTCGGG + Intergenic
1197470928 X:126865125-126865147 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1197499691 X:127228620-127228642 TTGGAGCTTTATTTAATGTCGGG - Intergenic
1197933047 X:131714093-131714115 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1198598418 X:138260841-138260863 TTGGAGTTTTATTTAATGTCAGG - Intergenic
1198965891 X:142228572-142228594 TTGGAGCTTTATTTAATGTCAGG - Intergenic
1199576450 X:149317715-149317737 TTGGAGTTTTATTTAATGTTGGG - Intergenic
1199748795 X:150794820-150794842 TTGCAGATTTCTCTCATGTCTGG - Intronic
1199750665 X:150814463-150814485 TTGCAGATTTCTCTCATGTCTGG - Intronic
1200532869 Y:4359060-4359082 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1200611173 Y:5328445-5328467 TTGGAGTTTTATTTAATGTCGGG + Intronic
1200659583 Y:5943228-5943250 TTGGAGTTTTATTTAATGTCGGG - Intergenic
1200675294 Y:6141236-6141258 TTTGAGTTTTATTTAATGTCAGG - Intergenic
1201307535 Y:12563596-12563618 TTGGAGCTTTATTTAATGTCAGG + Intergenic
1201408035 Y:13668417-13668439 TTAGAGCTTTTTCTATAGTTTGG + Intergenic
1201473532 Y:14358086-14358108 TTGGAGTTTTATTTAATGTCAGG + Intergenic
1201581360 Y:15514422-15514444 TTGGAGTTTTATTTAATATCAGG - Intergenic