ID: 1066437385

View in Genome Browser
Species Human (GRCh38)
Location 10:35406920-35406942
Sequence GCTTTTTCTAATGTCGGGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437375_1066437385 16 Left 1066437375 10:35406881-35406903 CCCGTCGGGGCGGCCGGCCAGGC 0: 4
1: 13
2: 693
3: 5588
4: 7319
Right 1066437385 10:35406920-35406942 GCTTTTTCTAATGTCGGGAGCGG No data
1066437373_1066437385 17 Left 1066437373 10:35406880-35406902 CCCCGTCGGGGCGGCCGGCCAGG 0: 1
1: 3
2: 20
3: 835
4: 9782
Right 1066437385 10:35406920-35406942 GCTTTTTCTAATGTCGGGAGCGG No data
1066437380_1066437385 3 Left 1066437380 10:35406894-35406916 CCGGCCAGGCAGAGGGGCTTTTT 0: 1
1: 0
2: 2
3: 44
4: 256
Right 1066437385 10:35406920-35406942 GCTTTTTCTAATGTCGGGAGCGG No data
1066437367_1066437385 28 Left 1066437367 10:35406869-35406891 CCCACCTCCGTCCCCGTCGGGGC 0: 1
1: 0
2: 55
3: 4273
4: 3544
Right 1066437385 10:35406920-35406942 GCTTTTTCTAATGTCGGGAGCGG No data
1066437370_1066437385 24 Left 1066437370 10:35406873-35406895 CCTCCGTCCCCGTCGGGGCGGCC 0: 1
1: 0
2: 3
3: 104
4: 4660
Right 1066437385 10:35406920-35406942 GCTTTTTCTAATGTCGGGAGCGG No data
1066437382_1066437385 -1 Left 1066437382 10:35406898-35406920 CCAGGCAGAGGGGCTTTTTGGAG 0: 1
1: 0
2: 3
3: 15
4: 202
Right 1066437385 10:35406920-35406942 GCTTTTTCTAATGTCGGGAGCGG No data
1066437365_1066437385 29 Left 1066437365 10:35406868-35406890 CCCCACCTCCGTCCCCGTCGGGG 0: 1
1: 0
2: 58
3: 5067
4: 3416
Right 1066437385 10:35406920-35406942 GCTTTTTCTAATGTCGGGAGCGG No data
1066437376_1066437385 15 Left 1066437376 10:35406882-35406904 CCGTCGGGGCGGCCGGCCAGGCA 0: 1
1: 0
2: 1
3: 22
4: 151
Right 1066437385 10:35406920-35406942 GCTTTTTCTAATGTCGGGAGCGG No data
1066437363_1066437385 30 Left 1066437363 10:35406867-35406889 CCCCCACCTCCGTCCCCGTCGGG 0: 1
1: 0
2: 62
3: 5118
4: 3550
Right 1066437385 10:35406920-35406942 GCTTTTTCTAATGTCGGGAGCGG No data
1066437368_1066437385 27 Left 1066437368 10:35406870-35406892 CCACCTCCGTCCCCGTCGGGGCG 0: 1
1: 0
2: 48
3: 4016
4: 3547
Right 1066437385 10:35406920-35406942 GCTTTTTCTAATGTCGGGAGCGG No data
1066437372_1066437385 21 Left 1066437372 10:35406876-35406898 CCGTCCCCGTCGGGGCGGCCGGC 0: 1
1: 3
2: 71
3: 4210
4: 3025
Right 1066437385 10:35406920-35406942 GCTTTTTCTAATGTCGGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066437385 Original CRISPR GCTTTTTCTAATGTCGGGAG CGG Intronic
No off target data available for this crispr