ID: 1066437386

View in Genome Browser
Species Human (GRCh38)
Location 10:35406925-35406947
Sequence TTCTAATGTCGGGAGCGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066437376_1066437386 20 Left 1066437376 10:35406882-35406904 CCGTCGGGGCGGCCGGCCAGGCA No data
Right 1066437386 10:35406925-35406947 TTCTAATGTCGGGAGCGGATTGG No data
1066437372_1066437386 26 Left 1066437372 10:35406876-35406898 CCGTCCCCGTCGGGGCGGCCGGC No data
Right 1066437386 10:35406925-35406947 TTCTAATGTCGGGAGCGGATTGG No data
1066437380_1066437386 8 Left 1066437380 10:35406894-35406916 CCGGCCAGGCAGAGGGGCTTTTT No data
Right 1066437386 10:35406925-35406947 TTCTAATGTCGGGAGCGGATTGG No data
1066437375_1066437386 21 Left 1066437375 10:35406881-35406903 CCCGTCGGGGCGGCCGGCCAGGC No data
Right 1066437386 10:35406925-35406947 TTCTAATGTCGGGAGCGGATTGG No data
1066437373_1066437386 22 Left 1066437373 10:35406880-35406902 CCCCGTCGGGGCGGCCGGCCAGG No data
Right 1066437386 10:35406925-35406947 TTCTAATGTCGGGAGCGGATTGG No data
1066437382_1066437386 4 Left 1066437382 10:35406898-35406920 CCAGGCAGAGGGGCTTTTTGGAG No data
Right 1066437386 10:35406925-35406947 TTCTAATGTCGGGAGCGGATTGG No data
1066437370_1066437386 29 Left 1066437370 10:35406873-35406895 CCTCCGTCCCCGTCGGGGCGGCC No data
Right 1066437386 10:35406925-35406947 TTCTAATGTCGGGAGCGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066437386 Original CRISPR TTCTAATGTCGGGAGCGGAT TGG Intronic