ID: 1066441094

View in Genome Browser
Species Human (GRCh38)
Location 10:35439807-35439829
Sequence GCCACTCCCTTGTTACTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066441087_1066441094 25 Left 1066441087 10:35439759-35439781 CCTTCTGTTTTAGTTGACTTATG 0: 1
1: 0
2: 2
3: 22
4: 246
Right 1066441094 10:35439807-35439829 GCCACTCCCTTGTTACTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066441094 Original CRISPR GCCACTCCCTTGTTACTGCC AGG Intronic
No off target data available for this crispr